Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 975

1 members and 974 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,928
Threads: 249,128
Posts: 2,572,274
Top Poster: JLC (31,651)
Welcome to our newest member, arushing027
Results 1 to 5 of 5
  1. #1
    Registered User
    Join Date
    06-29-2018
    Posts
    2
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Feeding schedule for neonate ball pythons and such?

    What is the length of time between meals before resorting to force feeding babies? Starting from time out of the egg and then between meals if using live pinkies (will try to update with relative pinkie weights). I just got my first hatchlings of the year I got four healthy axanthic babies. This is my biggest year yet and I'm expecting alot of babies and the organizational task of managing the feeding schedule. Looking for system pointers. I raise my own Norway, multimammate, and field mice stock so I have a steady supply of anysize rodent. Anyone got a spreadsheet though they wanna share?

    This is my first post, I'm looking for personal experience from people who have done this more than me, last year I had 21hatchlings and only 15 survived. Wanna do better this year so I'm trying to participate on here. I can provide other details upon request, don't wanna give you all my life story just yet.

    BTW my name is James, check me out on Instagram @silverserpenteg we sell alot more than snakes!

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    First I would skip over pinks and move straight to hopper mice as they elicit an almost immediate feed response for most hatchling balls.

    I generally do not force feed until a couple months have gone by.

    As far as how often to feed... For the first six months or so I feed as often as they will eat. After that I move to a 5-7 day cycle.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Alicia (07-06-2018),Craiga 01453 (07-06-2018),GalaxyMom (10-06-2018)

  4. #3
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    Your best chance to get them started fast and taking the first meal offered is first have optimum husbandry which mean security, second offer a live hopper mouse (you will get a higher percentage of animals eating their first meal offered compared to rats)

    After that it varies and depend on a few factors, weight of the animal, whether the animal absorbed his yolk or not etc

    After 3 failed feedings I will change things around, different prey, hide, different substrate but on average with a healthy animal I give it 6 to 8 feedings before assisting.

    That type of thing is really a case by cases thing.
    Last edited by Stewart_Reptiles; 07-06-2018 at 09:44 AM.
    Deborah Stewart


  5. The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    Alicia (07-06-2018),GalaxyMom (10-06-2018)

  6. #4
    Registered User
    Join Date
    06-29-2018
    Posts
    2
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Feeding schedule for neonate ball pythons and such?

    Quote Originally Posted by asplundii View Post
    First I would skip over pinks and move straight to hopper mice as they elicit an almost immediate feed response for most hatchling balls.

    I generally do not force feed until a couple months have gone by.

    As far as how often to feed... For the first six months or so I feed as often as they will eat. After that I move to a 5-7 day cycle.

    Thanks for the hopper tip. How many months are we talking before force feeding, 2 or 3? Before I should start to be concerned.

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Feeding schedule for neonate ball pythons and such?

    Quote Originally Posted by SilverSerpentExotics View Post
    Thanks for the hopper tip. How many months are we talking before force feeding, 2 or 3? Before I should start to be concerned.
    Depends on the individual animal really. If it seems to be holding weight and not declining then I am less likely to force feed. If it is looking poor and losing weight rapidly then I try an assist feed to get it going.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    GalaxyMom (10-06-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1