Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 667

2 members and 665 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,106
Posts: 2,572,115
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 1 of 2 12 LastLast
Results 1 to 10 of 14
  1. #1
    Registered User
    Join Date
    12-04-2017
    Posts
    3
    Thanks
    3
    Thanked 0 Times in 0 Posts

    Question do albinos not like heat lamps?

    hi! i've had my juvenile male ball python named monty, who is an albino, for about a month and a half now. he is my first snake ever.

    i have noticed that he goes into the hide he has on the cool (80°F) side of the cage a lot instead of his hide on the warm side (95°F). for the daytime, i use a 100w heat lamp. for nighttime, i use a 100w ceramic heat emitter (it's worth noting that bc of the lack of light, i can't see him). i also use a UTH for secondary heating. i don't think it's because the temp on the warm side is too high, because it's almost always at the recommended 95°F. however, correct me if i'm wrong!

    i initially thought that perhaps monty just personally prefers cooler temperatures. then i thought, well, human albinos can't stay out in the sun very long without sunburns, so is it the same for snakes? what if his heat lamp bothers him during the daytime?

    i couldn't find any information relating to this specifc inquiry online, so i made this thread. i love monty so much and i want him to be as comfortable as possible, so if his heat lamp is potentially causing him problems i will replace it immediately.

    if anyone could help me on this, i would very much appreciate it. thank you.

  2. #2
    Registered User OneEyedFox's Avatar
    Join Date
    01-10-2017
    Location
    Midland Texas
    Posts
    330
    Thanks
    41
    Thanked 151 Times in 114 Posts

    Re: do albinos not like heat lamps?

    Ball pythons are nocturnal so they are going to stay hidden when any light is on (unless it's infrared cause from what I've been told they can't really pick up on that) your hot side temp is a bit too high though. My hot side is kept at about 88° though from all of my experience, other friends that keep BPs, and readings I've done, the hot side should stay between 88 and 92. There's no proof that albino BPs don't like light, and I doubt that they don't. It's probably a matter of too hot temperatures or possibly that he can't fit in his hot hide? I don't provide day night cycles for my snake but if you are using a bright white light for the day time, that could also be why he's staying on the cool side, he's nocturnal, that bright light means it's day time and it's time for him to sleep, and hide.


    Sent from my iPhone using Tapatalk
    1.0 Normal BP "Calliope"
    0.1 Hypo Leopard Gecko “El”
    1.0 Normal Leopard Gecko “Axle”
    0.0.1 Poecilotheria Regalis
    0.0.1 Poecilotheri Subfusca
    1.0 Siamese mix cat “Kurt”
    1.0 DLH Cat “Vodka”
    0.0.1 Suriname Red Tail Boa

    "I’m just more comfortable with fauna and flora than with other humans."

  3. The Following 2 Users Say Thank You to OneEyedFox For This Useful Post:

    Alicia (12-12-2017),foster (12-12-2017)

  4. #3
    Registered User Codil7's Avatar
    Join Date
    11-12-2013
    Posts
    80
    Thanks
    39
    Thanked 22 Times in 18 Posts
    Images: 1

    Re: do albinos not like heat lamps?

    Quote Originally Posted by foster View Post
    hi! i've had my juvenile male ball python named monty, who is an albino, for about a month and a half now. he is my first snake ever.

    i have noticed that he goes into the hide he has on the cool (80°F) side of the cage a lot instead of his hide on the warm side (95°F). for the daytime, i use a 100w heat lamp. for nighttime, i use a 100w ceramic heat emitter (it's worth noting that bc of the lack of light, i can't see him). i also use a UTH for secondary heating. i don't think it's because the temp on the warm side is too high, because it's almost always at the recommended 95°F. however, correct me if i'm wrong!

    i initially thought that perhaps monty just personally prefers cooler temperatures. then i thought, well, human albinos can't stay out in the sun very long without sunburns, so is it the same for snakes? what if his heat lamp bothers him during the daytime?

    i couldn't find any information relating to this specifc inquiry online, so i made this thread. i love monty so much and i want him to be as comfortable as possible, so if his heat lamp is potentially causing him problems i will replace it immediately.

    if anyone could help me on this, i would very much appreciate it. thank you.
    What type of enclosure are you using? Aquarium? Tub? What size? Are you using a thermostat/dimmer for the heat lamp? Where do you have your lamp positioned over the enclosure? What are you using to gauge the temps?

    When I first created my balls enclosure, she was in a 20 long and I used a 60 watt heat lamp to heat her enclosure in the colder months. I was using analog gauges and those darn things read wrong consistently. I quickly bought a temp gun and used that. Turns out the spot directly under the lamp would spike to well over 100 degrees even with a 60 watt bulb.

    If your ambient temps are reading 95, my guess is that the lamp is causing a much higher ground temperature making the warm side unbearable. Also is your UTH on a thermostat as well? Those will peak the ground temps to much higher levels than desired if not.


    Sent from my iPhone using Tapatalk
    1.0 Catahoula (Easton)
    1.0 Chocolate Lab/Weimeraner (Gunner)
    0.1 Black Pewter het Albino (Arya)
    0.1 BCI (Kaiya)

  5. The Following 2 Users Say Thank You to Codil7 For This Useful Post:

    Alicia (12-12-2017),foster (12-12-2017)

  6. #4
    Registered User
    Join Date
    12-04-2017
    Posts
    3
    Thanks
    3
    Thanked 0 Times in 0 Posts

    Re: do albinos not like heat lamps?

    Quote Originally Posted by OneEyedFox View Post
    Ball pythons are nocturnal so they are going to stay hidden when any light is on (unless it's infrared cause from what I've been told they can't really pick up on that) your hot side temp is a bit too high though. My hot side is kept at about 88° though from all of my experience, other friends that keep BPs, and readings I've done, the hot side should stay between 88 and 92. There's no proof that albino BPs don't like light, and I doubt that they don't. It's probably a matter of too hot temperatures or possibly that he can't fit in his hot hide? I don't provide day night cycles for my snake but if you are using a bright white light for the day time, that could also be why he's staying on the cool side, he's nocturnal, that bright light means it's day time and it's time for him to sleep, and hide.
    Quote Originally Posted by Codil7 View Post
    What type of enclosure are you using? Aquarium? Tub? What size? Are you using a thermostat/dimmer for the heat lamp? Where do you have your lamp positioned over the enclosure? What are you using to gauge the temps?

    When I first created my balls enclosure, she was in a 20 long and I used a 60 watt heat lamp to heat her enclosure in the colder months. I was using analog gauges and those darn things read wrong consistently. I quickly bought a temp gun and used that. Turns out the spot directly under the lamp would spike to well over 100 degrees even with a 60 watt bulb.

    If your ambient temps are reading 95, my guess is that the lamp is causing a much higher ground temperature making the warm side unbearable. Also is your UTH on a thermostat as well? Those will peak the ground temps to much higher levels than desired if not.
    then i actually think the temp might be too high for him to be comfortable. i don't think it's unbearable for him, though, because i DO see him go in the warm side from time to time, it's just that it's not often. it's clear that he prefers the hide on the cool side.

    he is in a 30" x 12" x 12" glass terrarium with a sliding screen top. the lamp is positioned over the right side of the enclosure, where the warm side is, while the cool side is on the left. the UTH is on the left side. i bought one of those zoomed 20 gallon snake starter kits (rest assured i have more furniture in his terrarium than the half-log it came with) that included an analog thermometer so that one is on the hot side... i had bought a digital thermometer + digital hygrometer but while i was at petsmart there was only one digital thermometer in stock, so i figured the analog would have had to do for now. i am ordering another digital thermometer right at this moment.

    i do not have a thermostat. i was looking at this one, though. it's really expensive for me (which is why i was waiting to buy it), because i'm just a teenager, but i'll pay whatever price i need to for monty.

    thank you both for your help. i was wondering if it was because of his albinism that he was avoiding the hot side but now i definitely think it's because it's too warm for him.
    Last edited by foster; 12-12-2017 at 03:42 AM.

  7. #5
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    do albinos not like heat lamps?

    I'm thinking it's just far too warm in there to be honest , maybe dangerously so as well .

    As you know a thermostat is essential to regulate the heat sources plus a digital thermometer with a wired probe for taking the SURFACE temps under the warm hide ... in my experience none of my Royals / Balls wanted it to be as high as 95F .... worse still it sounds like you're using one of those crappy stick on thermometers which are sadly inaccurate and they only give AMBIENT ( surrounding air ) temps .

    I'm guessing the temperature under the warm hide is well over a 100F !!

    Also did you mention that you also have an unregulated heat mat under the cool side as well ??

    That heat mat maybe unnecessary and even dangerously hot if there's no thermostat regulating the temperature.




    Sent from my iPhone using Tapatalk Pro
    Last edited by Zincubus; 12-12-2017 at 08:42 AM.




  8. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: do albinos not like heat lamps?

    Quote Originally Posted by OneEyedFox View Post
    There's no proof that albino BPs don't like light, and I doubt that they don't.
    With respect, you are mistaken here. It is very well documented that animals suffering from albinism have an aversion to light because the lack of melanin in their eyes makes the extremely photosensitive. Back in the early days of keeping (before heat tape was a thing), this behaviour in ball pythons was actually the root of a rumor that the morph had fertility issues because the females would avoid the areas of their enclosures with heat lamps while they were gravid/incubating and so their clutches would not develop properly.


    That said... As has been observed by everyone, the bigger issue here is likely that your hotspot is too hot. I would do without the heat lamp and just use the heat mat hooked in to a thermostat and set it so that you have a temp of ~86-88F
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Alicia (12-12-2017),Zincubus (12-12-2017)

  10. #7
    BPnet Veteran MD_Pythons's Avatar
    Join Date
    10-02-2017
    Location
    Silver Spring, MD
    Posts
    552
    Thanks
    441
    Thanked 340 Times in 205 Posts

    Re: do albinos not like heat lamps?

    The Jump Start thermostats are more affordable, I'd also get a dimmer so you can regulate the heat lamp.

  11. The Following 2 Users Say Thank You to MD_Pythons For This Useful Post:

    foster (12-12-2017),Pezz (12-12-2017)

  12. #8
    BPnet Veteran SDA's Avatar
    Join Date
    08-25-2017
    Location
    West Tennessee
    Posts
    1,559
    Thanks
    220
    Thanked 1,478 Times in 824 Posts

    Re: do albinos not like heat lamps?

    Quote Originally Posted by asplundii View Post
    With respect, you are mistaken here. It is very well documented that animals suffering from albinism have an aversion to light because the lack of melanin in their eyes makes the extremely photosensitive.
    The only big issue with albino anything in a cage environment is excessive ultra violet light. The problem is their lack of melanin means they are not protected from UV radiation and as such it can cause skin complications. Bright sunlight and the moderate to minor lighting found in reptile cages are two different things. A heat lamp is not going ot produce enough light to cause photosensitivity. So yes, jarring excessively bright light is harmful to albino snakes but then again it is to normal snakes as well. Neither can close their eyes and harsh lighting is not healthy for their eyes. That does not mean that an albino snake should live in darkness, just like any other snake, a phto period or day /night cycle is perfectly beneficial to them. Just avoid UV lighting, especially UVB.
    1.0 ♂ 2010 Spider BP 'Dante'
    1.0 ♂ 2017 Bay of LA Rosy Boa 'Queso'
    0.0.1 2017 Aru GTP 'Ganja'
    1.0 ♂ Blue Tick Coonhound 'Blue'

    1.0 ♂ 2018 Basset Hound 'Cooper'

  13. #9
    Registered User larryd23's Avatar
    Join Date
    10-08-2017
    Location
    Long Island, New York
    Posts
    184
    Thanks
    116
    Thanked 141 Times in 89 Posts

    Re: do albinos not like heat lamps?

    Quote Originally Posted by Zincubus View Post
    I'm thinking it's just far too warm in there to be honest , maybe dangerously so as well .

    As you know a thermostat is essential to regulate the heat sources plus a digital thermometer with a wired probe for taking the SURFACE temps under the warm hide ... in my experience none of my Royals / Balls wanted it to be as high as 95F .... worse still it sounds like you're using one of those crappy stick on thermometers which are sadly inaccurate and they only give AMBIENT ( surrounding air ) temps .

    I'm guessing the temperature under the warm hide is well over a 100F !!

    Also did you mention that you also have an unregulated heat mat under the cool side as well ??

    That heat mat maybe unnecessary and even dangerously hot if there's no thermostat regulating the temperature.
    Since we made the mistake of having a UTH without a thermostat when we set up our Exo Terra habitat, I'll chime in.

    When measuring the heat generated by your UTH, you must measure the temp on top of the UTH, not on top of the substrate above the UTH. Our Ultratherm UTH measured 110 degrees without a thermostat. I have read the the Zoomed UTHs are equally hot. From what I have read here an elsewhere, a 110 degree UTH can seriously harm your BP. Personally, I am appalled that Zoomed sells their setup without a thermostat.

  14. #10
    Registered User
    Join Date
    12-04-2017
    Posts
    3
    Thanks
    3
    Thanked 0 Times in 0 Posts
    oh my goodness thank you all so so much... i am so glad i started this thread so that these issues could come to my attention. i had no idea that the hot spot would be too warm for him. i am ordering the dimmer and looking at thermostats right now. in the meantime i've turned the lamp off.

    if anyone has any other advice i would appreciate it so much.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1