Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 976

1 members and 975 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,098
Threads: 249,243
Posts: 2,572,933
Top Poster: JLC (31,651)
Welcome to our newest member, nightfallvt
Page 1 of 4 1234 LastLast
Results 1 to 10 of 40
  1. #1
    Registered User
    Join Date
    10-02-2017
    Location
    Kansas
    Posts
    23
    Thanks
    2
    Thanked 7 Times in 3 Posts

    Ball python single gene morph descriptions -need feedback

    My name is Kyle Atkins-Weltman, and I am a snake keeper and undergraduate researcher at the University of Kansas. I am doing a project that involves describing the inheritance and phenotypes of simple dominant or recessive ball python mutations, and I am posting here because I need help from experienced keepers and breeders. Much of my information has come from World of Ball Pythons, which I understand is not a perfectly reliable source, and so I am trying to double check all of my data. Below I have included tables for my current dataset of dominant and recessive morphs, including my current descriptions (? are ones that I need assistance in describing). I have already omitted listings that had no pictures, or no information on the breeder who first proved the trait. Furthermore, phenotypes that were listed as lines of a trait were treated as a single trait to avoid pseudoreplication (though if there is evidence of non-complimentation between different lines of any trait, please let me know). I have also included a document that illustrates our terminology, because as a scientific endeavor we must be consistent. However, I also cannot seem to figure out how to upload non-image attachments to this forum, so any help there is appreciated. I will be more than happy to share any of my findings with those who are interested once the project is finished. Thanks in advance!

    P.S. if there are any new ones that I have missed, please do let me know!
    Dominant morphs:
    Araza Could not determine phenotype
    Ashen Reddish-brown cranial patterning.
    Bald Gene Increased number of blotches, possibly also replacement of vertebral stripe with blotches, lateral background exhibits intrusion of paler colors between blotches, expanded whitewalls around blotches.
    BiancaBall Pale ventral coloration extends further up flanks of animal than in wildtype, particularly in connected blotches; pale coloration dimishes quickly resulting in pixelated appearance with pale yellow or white scales scattered on ventral portion of lateral blotches.
    Black Adder Loss of vertebral stripe. Possible expansion of blotches and absence of disconnected blotches.
    Black Belly Irregular and incomplete dark stripe running along ventral midline.
    Black Knight Appears to be some disruption of the broken vertebral stripe, which only appears in the form of occasional spots.
    Blitz Smaller and more fragmentary blotches with larger internal spots.
    Brite Ball ?
    Calico The more ventral regions of the lateral blotches in this mutant are largely white, with some intrusion of the normal lateral background color, leading to a semi-speckled appearance.
    Coffee Increased invasion of paler brown coloration into dark lateral background coloration between blotches.
    Cupid Could not determine phenotype
    Daisy Lateral blotches tend to be broken up by numerous smaller dark spots rather than one or two large spots. Vertebral stripe possibly more continuous that it typically is.
    Deme Ball ?
    Enigma Could not determine phenotype
    Epic Increased number of dorsally connected blotches, and an increase in the number of spots.
    Freak Could not determine phenotype
    Fuego Could not determine phenotype
    Galaxy Increased number of ventrally connected, multi-spotted lateral blotches. The spots within these blotches are small and irregular, giving a speckled appearance. There is also an increase in spots within the vertebral stripe.
    Genetic Banded (Pacific Coast Reptiles) Pattern consists of large, ventrally connected lateral blotches for the first ~20% of the animal's length. The posterior patterning consists of large blotches that are both ventrally and dorsally connected, forming a banding pattern. Spots are completely absent. Broken vertebral stripe is only present along the first ~20% of the animal, and from the vent to the tip of the tail.
    Harlequin Could not determine phenotype
    High Yellow Could not determine phenotype
    Joppa Could not determine phenotype
    Josie Ball Expansion of ventral whitewall. Three faded white brown spots form a triangle within the normal cranial patterning - with the "point" of the triangle pointing posteriorly. There is also an increased number of spots, largely within the dorsal regions of the ventrally-connected lateral blotches.
    Jumanji Ball Could not determine phenotype
    Kosmos Increased number of disconnected and ventrally connected lateral blotches. Within these blotches, there are many small, irregularly shaped spots, similar to those seen in the Daisy and Galaxy phenotypes. Vertebral stripe is less broken than in wildtype, with some small spots.
    Ktulu Could not determine phenotype
    Leopard Ball Lateral blotches of all types are far larger than in wildtype, often connecting to each other to form large, irregularly shaped brown bands. There is a greater number of spots than in the wildtype, and these largely occur on the dorsal sides of the flanks. The remnants of the broken vertebral stripe can be observed just behind the neck, and from the vent to the tip of the tail.
    Lucifer Could not determine phenotype
    Mandarin ?
    Milk Chocolate Could not determine phenotype
    Nanny Ball The margins of the lateral blotches of all types are far more irregular than in a wildtype, and all have multiple small, irregular spots within them. The vertebral stripe is also more broken than in the wildtype, consisting of a greater number of shorter segments.
    Nova Almost all anterior blotches are single-spotted - spot is directly in the center of the blotch. The spots also occur within the broken vertebral stripe. Coloration of broken vertebral stripe is slightly brighter than the lateral blotches. Increased lateral background coloration within darkwall.
    Nyala Could not determine phenotype
    Ofy Lateral blotches are anteropsoteriorly elongated, leading to far thinner black banding. There is also a darker brown stripe between the pale ventral coloration and the typical lateral background coloration, with small flecks of black. The cranial pattern has three light brown spots, forming a triangle that points posteriorly.
    Orange Glow Lateral blotches are anteroposteriorly expanded, leading to largely brown flanks, with multiple spots. There appear to be no disconnected lateral blotches. The broken vertebral stripe is only present on the neck of the animal.
    Pinstripe The body is largely brown, with two irregular, broken black lateral stripes on the dorsolateral part of the animal. Sometimes, black coloration will project ventrally rom these broken stripes, forming something reminiscent of the wild-type pattern. There are also black spots and flecking along the body as in the wild-type. The head is brown rather than black, and each stripe that goes through the eyes is bordered dorsally by a dark brown stripe.
    Radioactive Pattern is somewhat similar to the wild-type, but the Copper brown coloration is replaced with a bright yellow. Additionally, there is a great number of small brown flecks within the yellow blotches.
    Raven Could not determine phenotype
    Reaper [Seems very similar to Galaxy and Daisy mutants]
    Redhead Reddish-brown cranial pattern, and an increased number of spots within the lateral blotches. Based on 3 photos of one individual.
    Sienna There is a larger number of dorsally connected, multi-spotted lateral blotches in this phenotype. Some blotches are both dorsally and ventrally connected, forming irregularly shaped transverse bands.
    Sierra ?
    Solar Ball ?
    Spider Largely brown or tan rather than black, with white or off-white ventral coloration extending dorsally, which may include flecks of tan and brown. Black patterning forms very thin partial bands in some areas, as well as dorsal and lateral spots of varying size. There is a black band going across the internasals, which projects laterally to the nasals where it becomes a lateral stripe. This stripe extends posteriorly through the eye to the rearmost supralabial, where it then projects ventrally to posteriormost infralabial. Two stripes also project posteriorly from the internasals, extending to the frontals.
    Splash ?
    Static There is a greater number of dorsally-connected lateral blotches, which may also be ventrally connected to form irregular band-like patterning. Spots are irregularly distributed within these blotches. The ventral scutes show two broken, irregular longitudinal stripes of small black spots, which merge at the midline of the scutes just anterior to the vent.
    Sugar Very similar to Calico - the flanks in this mutant show a white coloration within the ventrally connected lateral blotches. Disconnected blotches are absent. Also, broken vertebral stripe is only present on the neck, and from the vent to the tip of the tail.
    Super Reduced Pattern This phenotype has far larger lateral blotches than in the wildtype, which are both ventrally and dorsally connected, Spots are far fewer in number, and broken vertebral stripe is entirely absent.
    Trick This phenotype has a greater number of lateral blotches, the vast majority of which are multi-spotted.
    Twister Could not determine phenotype
    Web There is a greater number of ventrally connected blotches in this phenotype, with some extending dorsally to form irregularly shaped bands. Spots are almost entirely absent. Posteriorly, the vertebral stripe is more broken than in the wildtype.
    Wilbanks Granite ?
    Woma Nearly identical to the "Spider" mutant phenotype, but without the white patterning on the sides.
    Recessive morphs:
    Albino Brown is replaced with varying shades of orange or yellow, black is replaced with white, and the eyes are red. Standard Tyrosinase-negative albino phenotype
    Atomic Could not find accessible photos.
    Autumn Gloss Vertebral stripe far less broken than in wildtype, almost completely connected from the base of the head to the tail. Ventrally-connected lateral blotches are heavily spotted. Based on four photos of one individual.
    Axanthic Same pattern as wild-type but browns are replaced with shades of gray. Supposedly become more brown with age.
    Banded Patterning consists of anteroposteriorly elongated ventrally and dorsally connected blotches, forming large tranverse bands. Spots are largely reduced, but are still present. Broken vertebral stripe absent except in the neck and from the vent to the tip of the tail. Also, ocular stripe is dorsoventrally expanded, encompassing the whole eye. There are 2 broken black stripes running along the vent.
    Bengal Copper coloration replaced with orange-brown, with greater intrusion of lateral background coloration into darkwall.
    Black Axanthic Incompatible with regular "axanthics" based on cross-breeding. Similar phenotype to regular axanthics, but do not gain brown coloration with age.
    Black Lace Vertebral stripe is far more connected than in the wildtype, and disconnected lateral blotches form occeli along the flanks.
    Caramel Albino Same pattern as wildtype, but with black replaced with a pale purple-lavender, and brown replaced with orange-yellow. Whitewall may be either white or cream-colored.
    Citrus Hypo Copper coloration replaced with orange, cranial pattern coloration is largely orange instead of black, though the margins still show the original black coloration.
    Clown Need help with this one
    Desert Ghost Copper brown coloration and all shades of brown replaced with shades of gray. Pattern identical to wild-type.
    Enhancer Ball Copper brown coloration replaced with shades of yellow. Dorsal head coloration is a light brown with black margin.
    G1 Hypo Brown colorations somewhat lighter than in wildtype, and the cranial patterning is lighter brown with a black margin
    Genetic Stripe Vertebral stripe is almost entirely unbroken. Additionally, there are no blotches on the flanks - instead, the flanks are largely Copper-brown, with occasional patches of darker brown.
    Ghost Copper brown is replaced with a light orange-brown color, with greater intrusion of lateral background color into the darkwall. Ventrall whitewall is expanded. Pattern is identical to wild-type. Based on 8 photos of 3 individuals.
    Lavender Albino Identical to Albino mutant, but black is replaced with lavender. Pattern is identical to wild-type. Based on 12 photos of 6 individuals.
    Monarch Copper brown is replaced with a tan-orange color, while black is replaced with a reddish brown.
    Orange Crush Copper brown is replaced with tan, and there is an increased intrusion of brown into the dorsal background coloration.
    Patternless All black coloration is absent - the only pattern remaining is the dorsoventral coloration, and there is a subtle remnant of the head patterning.
    Piebald Varying degrees of large, pure-white patches distributed across the body. Otherwise, color and pattern are normal
    Puzzle Ball ?
    Sahara Copper brown is replaced with an off-white color.
    Sentinel Copper brown is replaced with orange-brown, and there is an inrecased amount of this lateral background color showing within the darkwalls and the dorsal background coloration.
    Sunset Ball Copper brown is replaced with an orange coloration, while the black color is replaced with a reddish-brown.
    Toffee [Cannot visually distinguish from Lavender albino based on 14 photos of 5 individuals]
    Tri-Stripe Largely brown, with three broken black stripes running down the length of the animal. The blotches of the wildtype pattern here merge together to form largely Copper brown flanks, with darkwalls extending dorsally from the vent as in the wildtype.
    Albino Brown is replaced with varying shades of orange or yellow, black is replaced with white, and the eyes are red. Standard Tyrosinase-negative albino phenotype
    Atomic Could not find accessible photos.
    Autumn Gloss Vertebral stripe far less broken than in wildtype, almost completely connected from the base of the head to the tail. Ventrally-connected lateral blotches are heavily spotted. Based on four photos of one individual.
    Axanthic Same pattern as wild-type but browns are replaced with shades of gray. Supposedly become more brown with age.
    Banded Patterning consists of anteroposteriorly elongated ventrally and dorsally connected blotches, forming large tranverse bands. Spots are largely reduced, but are still present. Broken vertebral stripe absent except in the neck and from the vent to the tip of the tail. Also, ocular stripe is dorsoventrally expanded, encompassing the whole eye. There are 2 broken black stripes running along the vent.
    Bengal Copper coloration replaced with orange-brown, with greater intrusion of lateral background coloration into darkwall.
    Black Axanthic Incompatible with regular "axanthics" based on cross-breeding. Similar phenotype to regular axanthics, but do not gain brown coloration with age.
    Black Lace Vertebral stripe is far more connected than in the wildtype, and disconnected lateral blotches form occeli along the flanks.
    Caramel Albino Same pattern as wildtype, but with black replaced with a pale purple-lavender, and brown replaced with orange-yellow. Whitewall may be either white or cream-colored.
    Citrus Hypo Copper coloration replaced with orange, cranial pattern coloration is largely orange instead of black, though the margins still show the original black coloration.
    Clown Need help with this one
    Desert Ghost Copper brown coloration and all shades of brown replaced with shades of gray. Pattern identical to wild-type.
    Enhancer Ball Copper brown coloration replaced with shades of yellow. Dorsal head coloration is a light brown with black margin.
    G1 Hypo Brown colorations somewhat lighter than in wildtype, and the cranial patterning is lighter brown with a black margin
    Genetic Stripe Vertebral stripe is almost entirely unbroken. Additionally, there are no blotches on the flanks - instead, the flanks are largely Copper-brown, with occasional patches of darker brown.
    Ghost Copper brown is replaced with a light orange-brown color, with greater intrusion of lateral background color into the darkwall. Ventrall whitewall is expanded. Pattern is identical to wild-type. Based on 8 photos of 3 individuals.
    Lavender Albino Identical to Albino mutant, but black is replaced with lavender. Pattern is identical to wild-type. Based on 12 photos of 6 individuals.
    Monarch Copper brown is replaced with a tan-orange color, while black is replaced with a reddish brown.
    Orange Crush Copper brown is replaced with tan, and there is an increased intrusion of brown into the dorsal background coloration.
    Patternless All black coloration is absent - the only pattern remaining is the dorsoventral coloration, and there is a subtle remnant of the head patterning.
    Piebald Varying degrees of large, pure-white patches distributed across the body. Otherwise, color and pattern are normal
    Puzzle Ball ?
    Sahara Copper brown is replaced with an off-white color.
    Sentinel Copper brown is replaced with orange-brown, and there is an inrecased amount of this lateral background color showing within the darkwalls and the dorsal background coloration.
    Sunset Ball Copper brown is replaced with an orange coloration, while the black color is replaced with a reddish-brown.
    Toffee [Cannot visually distinguish from Lavender albino based on 14 photos of 5 individuals]
    Tri-Stripe Largely brown, with three broken black stripes running down the length of the animal. The blotches of the wildtype pattern here merge together to form largely Copper brown flanks, with darkwalls extending dorsally from the vent as in the wildtype.

  2. The Following 5 Users Say Thank You to reptilelover1995 For This Useful Post:

    Albert Clark (10-04-2017),Ax01 (10-04-2017),Devenco (01-13-2018),ShannaK (12-09-2017),ViolentTides (10-04-2017)

  3. #2
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    nice list!


    Dave Green discovered and proved out the Monsoon recessive: https://ball-pythons.net/forums/show...)-eggs-of-2016! it's awesome and reminds me of the Granite Burmese Python. he used to be active here on the forum, but is super busy with his projects and posts more on FB. Dave Green also hatched the 1st Super Champagne which unfortunately proved lethal.


    also another one: i'm not sure who the breeder was who discovered the Rainbow gene or tis history, but it's one recessive missing from your list. they're really bright and gorgeous animals. here are pix of some Rainbow combos and pix that are up for sale: https://www.morphmarket.com/us/c/rep.../trait/rainbow


    i think the Leopard and Pinstripe have been proven co-dominate. Justin Koblyka believes he has Super Leopards: https://ball-pythons.net/forums/show...-Super-Leopard


    also another breeder OWAL has been trying to prove out the Super Spider. he's done it, but it's lethal like the Super Champagne. here's a recent thread: https://ball-pythons.net/forums/show...Spider-results


    hope u stick around the forum and chime in with your insight now and then. good luck and keep us updated on your studies.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  4. The Following 3 Users Say Thank You to Ax01 For This Useful Post:

    Albert Clark (10-04-2017),Godzilla78 (10-04-2017),reptilelover1995 (10-04-2017)

  5. #3
    Registered User
    Join Date
    10-02-2017
    Location
    Kansas
    Posts
    23
    Thanks
    2
    Thanked 7 Times in 3 Posts

    Re: Ball python single gene morph descriptions -need feedback

    Thank you so much for your input! I will try to add/revise those on the list.

    Also, if anyone knows how I can share .pdfs on this forum so I can show our terminology, please let me know - I REALLY need to ensure that all of my descriptions are accurate in order for my analyses to be meaningful.

  6. #4
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Ball python single gene morph descriptions -need feedback

    Not sure if this applies but several lines of ghost have proven to be incompatible.

    If you can host the pdf of a third party site like google docs or similar we certainly would have no issues with you sharing a link to it.
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  7. #5
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Ball python single gene morph descriptions -need feedback

    IMO, a number of those "dominant" mutants are likely to be better classed as "not recessive" mutants. Spider is a case in point. World of Ball Pythons has it listed as a dominant, but not recessive is more accurate. As spider mated to normal produces both spider and normal babies, spider cannot be a recessive mutant. That's all we are certain of because no one has reported a homozygous spider ball python by breeding test. What little we do know makes spider look more like a codominant mutant that is lethal when homozygous.

    From what I've read on these forums, a homozygous pinstripe has been proven without reasonable doubt by breeding test, and the mutant is a dominant.

    I'd really like to see that terminology pdf file.

  8. #6
    Registered User
    Join Date
    10-02-2017
    Location
    Kansas
    Posts
    23
    Thanks
    2
    Thanked 7 Times in 3 Posts

    Re: Ball python single gene morph descriptions -need feedback

    Thanks for all the replies, this is very helpful. Yes, my main concern was that some of the things listed as "dominant" may in fact be codominant or otherwise not dominant. It is important for me to know this because obviously if I base my conclusions or findings on incorrect data, those conclusions or findings are meaningless. As soon as this reply is posted, I will edit my original post to include a link to the pdf of our wildtype description.

    Dr. Del, those ghost lines are indeed important, as non-complementation means that they are different loci despite being the same [or a highly similar] phenotype. Do you know which ones in particular have been crossed and proven incompatible with each other? I know that G1 Hypo and Ghost are incompatible based on my searches so far, but if there are more that is important for me to know.

    EDIT: because it won't let me go back and add to the original post, here is the link:
    https://drive.google.com/file/d/0B8G...ew?usp=sharing
    Last edited by reptilelover1995; 10-05-2017 at 09:09 AM.

  9. #7
    Registered User
    Join Date
    10-02-2017
    Location
    Kansas
    Posts
    23
    Thanks
    2
    Thanked 7 Times in 3 Posts

    Re: Ball python single gene morph descriptions -need feedback

    Quote Originally Posted by Ax01 View Post


    Dave Green discovered and proved out the Monsoon recessive: https://ball-pythons.net/forums/show...)-eggs-of-2016! it's awesome and reminds me of the Granite Burmese Python. he used to be active here on the forum, but is super busy with his projects and posts more on FB.


    also another one: i'm not sure who the breeder was who discovered the Rainbow gene or tis history, but it's one recessive missing from your list. they're really bright and gorgeous animals. here are pix of some Rainbow combos and pix that are up for sale: https://www.morphmarket.com/us/c/rep.../trait/rainbow
    Sorry for the double post, but I realized that I could not see the pictures in the thread on the Monsoon ball python. I could not access the photos on the post, and there is only one photo on WOBP. Ideally, I'd like to have multiple photos of multiple individuals expressing the same mutant allele, so that I know the phenotype I am describing is not just due to individual variation.

    As for the rainbow, I need to see pictures of single-gene mutants in order to describe the phenotype accurately, as multi-gene mutants have their phenotype altered by multiple genes and thus I cannot accurately determine what affects are due to the gene of interest. I found a page on in on WOBP, and from what I can tell it doesn't look any different from something like lavender albino. Has someone done crossings to determine whether or not this is just a new line of an already known mutant?

    ^That last part sums up why this project has been taking so long. Determining what morphs are "real" and which ones are just new listings of an already-known trait is extremely difficult, and it's part of why I've been describing each phenotype.
    Last edited by reptilelover1995; 10-05-2017 at 09:36 AM. Reason: Found picture of monsoon mutant

  10. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Ball python single gene morph descriptions -need feedback

    Quote Originally Posted by reptilelover1995 View Post
    Determining what morphs are "real" and which ones are just new listings of an already-known trait is extremely difficult, and it's part of why I've been describing each phenotype.
    With respect, I am not sure how long you have been researching but the "real" versus already known has been determined for everything on your list (and many that are not).


    Some things I noted from a quick review:

    Bald, Bright, Lucifer -- All of these are alleles of the BlkEL complex. Defining trait of this group is an inc-dom degree of hypomelanism with some pattern disruption. The homozygous forms are heavily hypomelanistic in the mild alleles up to leucistic in the strong alleles.

    Blitz, Trick, Spider, Woma, Harlequin, Nanny, Josie, Mandarin (likely a few others) -- All are inc-dom, not dom

    Harlequin is defined by having a pronounced display of the dorsal striping, often accompanied by a reduction in the display of the lateral pattern

    Nanny appears to be a Harlequin-type mutation.

    Axanthic -- There are four types (VPI, TSK, MJ, Joliff), none of which has been shown to be compatible with the others.

    DesertGhost, Sahara, Enhancer -- Have been shown to be compatible with one another. The mutation appears to have some effect on how pigment is deposited/displayed. This is most generally seen as a mild form of hypomelanism most easily seen with how it impacts the lighter areas of pattern

    Albino, Candy/Toffee -- These are proven alleles of the same gene.
    Lav and Rainbow have been proven to not be compatible with Albino. Likewise I have heard it reported that Lav and Rainbow have been proven to not be compatible with one another.
    The level of pigmentation displayed by Candy/Toffee, Lav, and Rainbow is markedly different between the morphs; Lav < Candy/Toffee < Rainbow

    Puzzle -- Disruption to the display of patterning with the "alien heads" being blended/melded. Lateral pattern also tends to be outlined in white to a higher degree

    Clown -- Patterning confined to the laterals, often causing fusing of lateral markings. Genetic black-backing. There is also a degree of hypo-pigmentation that accompanies the mutation
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #9
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    Great list!

    You forgot to include 'Jungle Woma'. I'm actually working with the gene and plan on breeding a big female for the first time this year. It gives the snake a bit more yellow and breaks up the pattern. The super form is called a 'Puzzle Back' (Super Jungle Woma). Here's what the super form looks like, I rarely see snakes with this gene for sale, it's not even mentioned in the book you referenced.



    You are actually missing a lot of genes in your list...

    Lesser / Butter - considered to be the same thing.

    Coral Glow / Banana - ditto...

    You may want to browse through this web page, it has most or all of the genes and combos that have been discovered to date, probably the most up to date info I have seen.

    http://www.worldofballpythons.com/morphs/?filter=1

    Also, keep in mind that many of these names are just made up by whoever discovered them, some I think are unfounded and complete BS (Some people name a recessive gene after their company name claiming that all their snakes are brighter than everyone else's, I won't mention any names in public LOL)
    Last edited by cchardwick; 10-05-2017 at 10:55 AM.


  12. The Following User Says Thank You to cchardwick For This Useful Post:

    luizillo (08-18-2019)

  13. #10
    Registered User
    Join Date
    10-02-2017
    Location
    Kansas
    Posts
    23
    Thanks
    2
    Thanked 7 Times in 3 Posts

    Re: Ball python single gene morph descriptions -need feedback

    Thanks for the additional info. I have been working on this for a while, but it has been difficult to find time to focus down on it. I'm glad I've made this post, as it has already helped me gather important info.

    As for the missing mutants you mentioned, due to the methods I am planning to use, I am not including incomplete dominant mutations (part of why I needed to post this, need to ensure I don't accidentally include incomplete dominant mutations).

    Thanks again!

Page 1 of 4 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1