Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 795

0 members and 795 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,699
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Page 1 of 2 12 LastLast
Results 1 to 10 of 12
  1. #1
    Registered User
    Join Date
    07-02-2017
    Posts
    74
    Thanks
    5
    Thanked 6 Times in 6 Posts
    Images: 5

    All the ways to get a white ball python?

    I'm wondering about all the ways to get a white ball python. Not just black or blue eye Lucy's. Anything all white or almost all white. So like grey freckiling and stuff is fine. Pics would be wonderful. Abvioisly include the combo names of both parents

  2. #2
    Registered User
    Join Date
    01-22-2017
    Posts
    12
    Thanks
    8
    Thanked 2 Times in 2 Posts

    Re: All the ways to get a white ball python?

    Yellowbelly x yellowbelleys make ivorys which can sometimes have abit of patterning.

    Spider pieds have a completely white body with a patterned head which looks cool. Blue eyed lucies vary in colour and whiteness too. Super mojaves have a grey head.



    Sent from my iPhone using Tapatalk

  3. #3
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: All the ways to get a white ball python?

    Quote Originally Posted by Python23 View Post
    Yellowbelly x yellowbelleys make ivorys which can sometimes have abit of patterning.

    Spider pieds have a completely white body with a patterned head which looks cool.
    Blue eyed lucies vary in colour and whiteness too. Super mojaves have a grey head.
    there are all white Spider Pieds too; they're called Spieds. Lesser Pieds are usually completely white too; they're called Lieds. j/k that was a lie. here's Ruby, my Lied guy... err i mean Lesser Pied.



    people love the Panda, but they are often very low pattern, white head and body except for a spot or two.

    also Cherry Bombs are all white with pinkish-red eyes. here's by baby Emerald:






    Edit: oh geez, how could i forget. Lol this is one of my projects - Snow Balls. here are some VPI Snow Balls - they have a hint of pattern and yellow: http://www.worldofballpythons.com/morphs/vpi-snow
    Last edited by Ax01; 10-03-2017 at 06:23 PM.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  4. The Following 2 Users Say Thank You to Ax01 For This Useful Post:

    Godzilla78 (10-04-2017),ViolentTides (10-03-2017)

  5. #4
    Registered User
    Join Date
    07-02-2017
    Posts
    74
    Thanks
    5
    Thanked 6 Times in 6 Posts
    Images: 5

    Re: All the ways to get a white ball python?

    I never knew a lesser pied made a white snake. So that’s a pied x lesser het pied right? And the snow balls are absolutely beautiful

  6. #5
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: All the ways to get a white ball python?

    Quote Originally Posted by CrazycatOP View Post
    I never knew a lesser pied made a white snake. So that’s a pied x lesser het pied right? And the snow balls are absolutely beautiful
    that's one way to get them. other pairings may include:
    Lesser het Pied x Lesser het Pied
    Lesser Pied x Pied
    Lesser het Pied x het Pied
    Lesser Pied x het Pied
    any Lesser-combo het Pied x Pied
    etc. etc.

    u can also swap out Lesser for Butter i suppose.

    but keep in mind Lesser Pieds are susceptible to Microphthalmia aka small eyes. get Super Lessers and they may get big, buggy eyes. get Lesser Pieds and they may have small eyes.



    i'm lucky in that my Ruby girl is perfect. (:
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  7. #6
    Registered User
    Join Date
    07-02-2017
    Posts
    74
    Thanks
    5
    Thanked 6 Times in 6 Posts
    Images: 5

    Re: All the ways to get a white ball python?

    Ever heard of a super orange belly? Not a yellow belly. Do they produce white snakes? I’m getting mixed info

  8. #7
    Registered User
    Join Date
    01-22-2017
    Posts
    12
    Thanks
    8
    Thanked 2 Times in 2 Posts

    Re: All the ways to get a white ball python?

    Quote Originally Posted by Ax01 View Post
    that's one way to get them. other pairings may include:
    Lesser het Pied x Lesser het Pied
    Lesser Pied x Pied
    Lesser het Pied x het Pied
    Lesser Pied x het Pied
    any Lesser-combo het Pied x Pied
    etc. etc.

    u can also swap out Lesser for Butter i suppose.

    but keep in mind Lesser Pieds are susceptible to Microphthalmia aka small eyes. get Super Lessers and they may get big, buggy eyes. get Lesser Pieds and they may have small eyes.



    i'm lucky in that my Ruby girl is perfect. (:
    Breeding super lesser pieds is absolutely pointless in my opinion. You're just going to get a completely white snake, which is a waste of the pied gene. If people want a white snake you might aswell do it with as little genes as possible.


    Sent from my iPhone using Tapatalk

  9. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: All the ways to get a white ball python?

    Quote Originally Posted by CrazycatOP View Post
    Ever heard of a super orange belly? Not a yellow belly. Do they produce white snakes? I’m getting mixed info
    OB is just another allele of YB. OB x YB makes an Ivory. Some people argue that all OB x OB will produce a GraphiteIvory but I have yet to see any documented proof of this.

    Quote Originally Posted by Python23 View Post
    Breeding super lesser pieds is absolutely pointless in my opinion. You're just going to get a completely white snake, which is a waste of the pied gene. If people want a white snake you might aswell do it with as little genes as possible.
    I have heard it argued that the white of a Pied is brighter/cleaner than the white of any BluEL, so it might not be a totally pointless project in that regard.



    Other white snakes:

    WomaPied and ChampPied can be all white
    There are some lines of BlkPastel that will occasionally throw all-whites when combined with Pied in the same manner as Spieds
    Any of the superforms in the BluEL group (with the possible exception of the Daddy allele) when combined with Pied; e.g., CrystalPied, PotionPied... But, as noted above, you get microphthalmia.
    Snows (already mentioned) and LavSnows
    If you stack enough other genes in Champs they seem to wash down to near-white, e.g., SuperPastel Champ Fire Lesser
    Albino SuperBlk/SuperCinny/8Ball though these might blush yellow with age
    Albino Suma might as well though I suspect they might blush yellow the same as above
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #9
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: All the ways to get a white ball python?

    Quote Originally Posted by Ax01 View Post
    that's one way to get them. other pairings may include:
    Lesser het Pied x Lesser het Pied
    Lesser Pied x Pied
    Lesser het Pied x het Pied
    Lesser Pied x het Pied
    any Lesser-combo het Pied x Pied
    etc. etc.

    u can also swap out Lesser for Butter i suppose.

    but keep in mind Lesser Pieds are susceptible to Microphthalmia aka small eyes. get Super Lessers and they may get big, buggy eyes. get Lesser Pieds and they may have small eyes.



    i'm lucky in that my Ruby girl is perfect. (:
    Quote Originally Posted by Python23 View Post
    Breeding super lesser pieds is absolutely pointless in my opinion. You're just going to get a completely white snake, which is a waste of the pied gene. If people want a white snake you might aswell do it with as little genes as possible.
    i've seen one Super Lesser Pied that had an all white body but with a lavenderish belly kinda like this lucy Burm: https://ball-pythons.net/forums/show...leucistic-baby i don't know if that was a once off, paradox thing tho. and a Super Lesser Pied can be very helpful in a project if the breeder wants to work the Lesser gene into everything (and create het Pieds). so no, its not absolutely pointless IMO. also Pied Lesser's and Pied Super Lesser's do not have blue eyes; they have black eyes w/ red pupils. so they offer something different besides their genetic power u can work into other projects. but to each their own.


    Edit:
    Quote Originally Posted by asplundii View Post
    I have heard it argued that the white of a Pied is brighter/cleaner than the white of any BluEL, so it might not be a totally pointless project in that regard.
    true dat!
    Last edited by Ax01; 10-04-2017 at 12:57 PM.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  11. #10
    Registered User
    Join Date
    07-02-2017
    Posts
    74
    Thanks
    5
    Thanked 6 Times in 6 Posts
    Images: 5

    Re: All the ways to get a white ball python?

    What is the simplest definition of an allele? I know it’s a gene related to another but how?

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1