» Site Navigation
1 members and 968 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,098
Threads: 249,243
Posts: 2,572,933
Top Poster: JLC (31,651)
|
-
Registered User
Breeding for specific morph(s) question
Hello, I just have a couple questions to get everyone's opinions on I've never personally bred a ball python ever but, I have been researching since early 2014 and slowly but surely in only 3 years I will be able to get my first BP, I already have a project I'm wanting to pursue because I find that this combo would just be gorgeous and I just love BP's that have axanthic related morphs (My fav is Axanthic pinstripe).
My question is, is it possible to breed for the morph Axanthic pinstripe piebald BP? I know axanthic is recessive, same as piebald, and pinstripe is dominant. Has this morph ever been successfully produced? I kept looking around the internet and I haven't found one yet! I have seen Axanthic Piebald's and Axanthic Pinstripes but are those three genes unable to be combined? Is this already a morph but under a different name?
I thought maybe this would work since pinstripe is a pattern morph and axanthic is a color but, how would adding a pattern morph like Piebald react to the pinstripe?
Thank you for reading my question and I hope someone can help me, I'm a early planner and I like knowing what I'm gonna get into ahead of time. :D
-
-
I don't see any reason these three genes can't be combined. I actually have a pinstripe pied, I could cross it with an Axanthic (which I don't have yet). Then I could take one of the pinstripe double het babies and breed them together. Actually if you used two pinstripe double hets you would have better odds, there's no super pinstripe as far as I know that has been proven out.
The odds are still pretty slim. For this project you would probably have to spend over $1,000 for the first pair of snakes, then wait until the female was mature, about three years. Then breed them and hatch the eggs and wait another three years to breed the babies. So you are looking at 6-7 years for the first clutch. Then with these odds you most likely won't hit them the first time, it may take several years of clutches of eggs to hit the odds, so you are probably looking at a 10 year project. For people with mature female snakes you may be able to cut off the first 3-4 years, that's the advantage of having multiple matures snakes, you can move projects along much faster. I'm guessing people are probably into this project already, maybe with years to go. And once you produce the axanthic pin pieds you will probably want to hold them back to breed, so that's another 3-4 years LOL. With two pin double hets here are your odds. Not sure many people would start this from scratch, it would be a long road with lots of normal, pins, axanthics, etc.
You could actually move it along much faster by crossing a pinstripe pied with an axanthic pied, but axanthic pieds will cost you about $3,000 right now. And you'll still get pin pieds that are het for axanthic, it will still take about 6 years but your odds will be better with pin pieds het for axanthic in the end.
Last edited by cchardwick; 08-07-2017 at 08:34 AM.
-
-
I would also add to what cchardwick's post by saying that, if you do decide to pursue the project, just remember that there are 5 different, non-compatible, lines of Axanthic so you want to make sure all the animals you start with are of the same line
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Breeding for specific morph(s) question
I was thinking that maybe I would use the VPI line? Since, they seem to on average keep their color better with age.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|