Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 662

0 members and 662 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 1 of 2 12 LastLast
Results 1 to 10 of 20
  1. #1
    Registered User RoyaLoveRay's Avatar
    Join Date
    12-05-2013
    Posts
    51
    Thanks
    76
    Thanked 1 Time in 1 Post
    Images: 2

    Coral Glow Genetics

    It's my understanding that breeding a coral glow to any other morph will produce all coral glows, (along with its mates traits) But I'm assuming that this is only true if it's a super coral glow, that is homozygous for coral glow, so that all offspring will be het for coral glow and appear darker in the coral glow aspect. Am I correct, or is there something else at work, genetically?

    Also, I see the coral glow trait portrayed as dominant. However, shouldn't it be considered codominant since the hets are not as bright as the homozygous forms? Thanks in advance

  2. #2
    Registered User Ballpythonguy92's Avatar
    Join Date
    11-20-2016
    Posts
    393
    Thanks
    214
    Thanked 115 Times in 91 Posts

    Re: Coral Glow Genetics

    Quote Originally Posted by RoyaLoveRay View Post
    It's my understanding that breeding a coral glow to any other morph will produce all coral glows, (along with its mates traits) But I'm assuming that this is only true if it's a super coral glow, that is homozygous for coral glow, so that all offspring will be het for coral glow and appear darker in the coral glow aspect. Am I correct, or is there something else at work, genetically?

    Also, I see the coral glow trait portrayed as dominant. However, shouldn't it be considered codominant since the hets are not as bright as the homozygous forms? Thanks in advance
    No you will get normals and I have had 3 clutches all male coral glows and mixed normals with males and females I've never had all female normals or all male normals so I don't believe it and yes if you had a super coral glow you would get all coral glows when bred to a normal or say a cinnamon you would get all coral cinnies

    Sent from my SM-G920W8 using Tapatalk

  3. The Following User Says Thank You to Ballpythonguy92 For This Useful Post:

    RoyaLoveRay (07-09-2017)

  4. #3
    Registered User
    Join Date
    06-06-2017
    Posts
    39
    Thanks
    13
    Thanked 19 Times in 12 Posts

    Re: Coral Glow Genetics

    Quote Originally Posted by RoyaLoveRay View Post
    It's my understanding that breeding a coral glow to any other morph will produce all coral glows, (along with its mates traits) But I'm assuming that this is only true if it's a super coral glow, that is homozygous for coral glow, so that all offspring will be het for coral glow and appear darker in the coral glow aspect. Am I correct, or is there something else at work, genetically?

    Also, I see the coral glow trait portrayed as dominant. However, shouldn't it be considered codominant since the hets are not as bright as the homozygous forms? Thanks in advance
    If you breed a coral glow to a normal you would get normals and coral glows. 50/50 chance

  5. The Following User Says Thank You to Mr.Snake For This Useful Post:

    RoyaLoveRay (07-09-2017)

  6. #4
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: Coral Glow Genetics

    Coral Glow is co-dom

    CG x normal = 50% CG 50% Normal

    CG x CG = 50% CG 25% Super CG 25% Normal

    Super CG x Normal = 100% CG


    Sent from my SM-G900V using Tapatalk
    Deborah Stewart


  7. The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    Craiga 01453 (07-15-2017),RoyaLoveRay (07-09-2017)

  8. #5
    Registered User RoyaLoveRay's Avatar
    Join Date
    12-05-2013
    Posts
    51
    Thanks
    76
    Thanked 1 Time in 1 Post
    Images: 2

    Re: Coral Glow Genetics

    Thanks for that guys. As a follow up question, does a male maker or a female maker have to be a super coral glow? Or can a het coral glow be one?

  9. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Coral Glow Genetics

    Quote Originally Posted by RoyaLoveRay View Post
    Thanks for that guys. As a follow up question, does a male maker or a female maker have to be a super coral glow?
    Male/female-maker has to do with the parent the animal inherited the CG trait from. If the CG came from a CG male it will be a male-maker and if the CG came from a CG female it will be a female-maker.

    Further, because the SuperCG is homozygous, it will make both male and female CGs because all of its offspring will be CG.

    Quote Originally Posted by RoyaLoveRay View Post
    Or can a het coral glow be one?
    When dealing with incomplete-dominant traits we as a hobby refer to the heterozygous animals as the morph and the homozygous as the "super" form. So the heterozygote is not "het CG", it is CG and then the homozygote is SuperCG
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #7
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Coral Glow Genetics

    Quote Originally Posted by Deborah View Post
    Coral Glow is co-dom

    CG x normal = 50% CG 50% Normal

    CG x CG = 50% CG 25% Super CG 25% Normal

    Super CG x Normal = 100% CG


    Sent from my SM-G900V using Tapatalk
    The trouble with this definition is that it does not distinguish between dominant and codominant genes. You'd get the same breeding results if coral glow is a dominant mutant gene.

    The coral glow (Cg) gene and the corresponding normal (+) gene can make three possible gene pairs, Cg/Cg (super coral glow, AKA homozygous coral glow), Cg/+ (coral glow, AKA heterozygous coral glow), and +/+ (normal, AKA homozygous normal).

    If the Cg gene is dominant to the normal gene, then the three types of snakes can only be separated into two groups. The +/+ snakes are in one group, and the Cg/Cg snakes and the Cg/+ snakes are in the other group. The Cg/Cg snakes and the Cg/+ snakes cannot be separated because they look alike. Only a breeding test can identify these snakes' genotypes.

    If the Cg gene is codominant to the normal gene, then the Cg/Cg snakes and the Cg/+ snakes and the normal snakes have different appearances and can be separated into three groups.

    From the pictures on worldofballpythons.com, I think there is enough difference between the look of a coral glow ball python and the look of a super coral glow ball python to call coral glow a codominant mutant gene.

  11. The Following User Says Thank You to paulh For This Useful Post:

    RoyaLoveRay (07-11-2017)

  12. #8
    Registered User
    Join Date
    03-24-2017
    Posts
    20
    Thanks
    15
    Thanked 4 Times in 3 Posts
    Am I missing something here or is the post above missing the point totally?

    EDIT: http://www.worldofballpythons.com/ar...s-co-dominant/
    Last edited by Joppsta; 07-13-2017 at 08:02 PM.

  13. #9
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Coral Glow Genetics

    Quote Originally Posted by RoyaLoveRay View Post
    ....

    Also, I see the coral glow trait portrayed as dominant. However, shouldn't it be considered codominant since the hets are not as bright as the homozygous forms? Thanks in advance
    Perhaps I did miss the point. I'm willing to debate the question.

    I took the OP's question (see quote) to be asking what makes a mutant gene dominant rather than codominant to the corresponding normal gene. I looked at that WOBP article, but it does not explain the difference between dominance and codominance. This link does: http://ballpython.ca/genetics-101/

  14. #10
    Registered User
    Join Date
    04-12-2016
    Posts
    148
    Thanks
    11
    Thanked 250 Times in 94 Posts

    Re: Coral Glow Genetics

    Maybe we should be trying to promote the correct terminology also. Why on earth people maintain the use of co-dominant, when we know it is incomplete dominant (a very different thing) is absurd. But sadly I see it used in books like the one from NERD, World of Ball Pythons, etc. It takes no more effort to actually state it factually.

    Warren

  15. The Following 2 Users Say Thank You to Warren_Booth For This Useful Post:

    asplundii (07-20-2017),Family Jewels (07-15-2017)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1