» Site Navigation
1 members and 3,097 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,694
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
I've heard that Calico white level parents dont effect the ofsprings white level
Is it like pied? Is it true?
-
-
Re: I've heard that Calico white level parents dont effect the ofsprings white level
yes it certainly appears to be random from all I have seen - though some combo's definitely influence the amount of white to an extraordinary level.
I'm talking about spider/ sugar/calico in particular.
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
The Following User Says Thank You to dr del For This Useful Post:
-
Registered User
Thank you Derek, But in the beginning you said its random and then: "though some combo's definitely influence the amount of white to an extraordinary level.
I'm talking about spider/ sugar/calico in particular."
So which is it? :-)
-
-
I don't know much about the calico gene, but even with pieds there are combos that add or subtract white. Cinnamon, spider, and black pastel will give you low white pieds while enchi increases pattern and decreases white.
I wouldn't be surprised if calico worked the same way. A lot of morphs are highly reactive to each other.
~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~
Check me out on iHerp, Instagram, & visit my store!

-
The Following User Says Thank You to the_rotten1 For This Useful Post:
-
Re: I've heard that Calico white level parents dont effect the ofsprings white level
 Originally Posted by the_rotten1
Cinnamon, spider, and black pastel will give you low white pieds
I believe you meant to say that Spider, Cinny and BlkPastel give you high-white Pieds 
 Originally Posted by the_rotten1
I wouldn't be surprised if calico worked the same way. A lot of morphs are highly reactive to each other.
Yeah, this is already kind of known though not really vocalized. YB, hetBluEL, Clown, and a couple others tend to decrease the visual expression of Calico/Sugar. Pastel and Enchi tend to increase expression
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
qwerty53 (06-13-2017),T_Redbull (06-18-2017)
-
Re: I've heard that Calico white level parents dont effect the ofsprings white level
I guess listing the combo caused a little confusion - if you remove "sugar/calico" from the sentence it may make it a little clearer.
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
The Following User Says Thank You to dr del For This Useful Post:
-
Re: I've heard that Calico white level parents dont effect the ofsprings white level
 Originally Posted by asplundii
I believe you meant to say that Spider, Cinny and BlkPastel give you high-white Pieds 
Yeah, I did. Must've been a typo. Thanks!
~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~
Check me out on iHerp, Instagram, & visit my store!

-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|