» Site Navigation
0 members and 787 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
for Sale in Germany: 100% het black eye lucy, gene that interacts with fire.
Hi there 
First of all, im not an expert when it comes to the fire-gene and the associated gene complex (disco, fire, sulfur, vanilla).
One of the most reputable breeders in Germany, Stefan Broghammer, has a gene for sale that behaves like follows: it doesnt look like fire, it doesnt look much like anything familiar but not quite normal either. Some strike me as really outstandingly beautiful. When you breed the gene to fire, you get a nice black-eyed leucistic that looks just like a super fire.
You can see them here:
http://www.ms-reptilien.de/index.php..._15_16_758_717
Unfortunately its in german, its about the snakes labeled ""het" Black Eye Lucy (M&S Linie)". They also have regular fires.
Its a reputable breeder, that is out of question, he authored and co-authored and published a number of books about snakes, and ball pythons. He even almost got a species of python named after him, but people abbreviate from python reticulatus broghammerus to python reticulatus. He also has for sale fire-like hatchlings that hatched from a fire-like looking ghana oddball that proved out to be genetic, and clearly labels them as "question" and "unproven", or even "Looks like fire to me, but who knows?".
So the gene is definitively for real, he sells them for years now, and they do what they are supposed to do. Considering the quantities, im quite sure that he gets them by breeding black-eye lucys that he produced with the gene to normals, and then sorts out the fires.
Now, my question for the fire-experts:
is this something new, or is it something that is already known under a different name? Fire is part of a gene complex, together with disco and sulfur and vanilla. Could it be one of these other already known genes? Yes you will need the link and need to look at some snake pics for this, so ill post some examples of the mystery gene to make it easier for you with the german website:
http://www.ms-reptilien.de/product_i...ducts_id=23136
http://www.ms-reptilien.de/product_i...ducts_id=24423
http://www.ms-reptilien.de/product_i...ducts_id=24424
http://www.ms-reptilien.de/product_i...ducts_id=24425 <--- i like this one the most
(EDIT: these links will go dead as snakes are sold, the top link should stay working)
so is it just all vanilla, or disco, or sulfur? Or is it a new gene in the black eye lucy complex? Or is it nothing except a black eye lucy-maker gene and we should keep calling it "het black eye lucy"? I think it will be an interesting riddle to solve. Im familiar with the fire-gene, but im ignorant about the other genes in this complex, so im lost here, cant get it figured out.
Last edited by Pythonfriend; 03-25-2013 at 02:43 PM.
-
-
Wow, that was a complicated post.
I would not say it does not look like Fire... I see bright color, blushing and a head stamp. Would need to see it with a few hundred more grams on it.
Also there are more Fire lines than just Fire and Sulfur already. Flame and Ember come to mind. So finding another line is no where near out of the realm of possibility.
-
-
for Sale in Germany: 100% het black eye lucy, gene that interacts with fire.
I'm not seeing pics of the snake? Can anyone repost them for me?
-
-
for Sale in Germany: 100% het black eye lucy, gene that interacts with fire.
http://ms-reptilien.shopgate.com/category/333734383636 let your iPhone take you here!! I looked around at the different stuff wishing I knew German haha but those hets you mentioned I like them ha they just look different then most other stuff this newb sees but idk how much they cost and I'm sure shipping would be killer
Normals 1.3
Spider .1
Carpet Python .1
Dog APBT .1
-
The Following User Says Thank You to carlson For This Useful Post:
-
Re: for Sale in Germany: 100% het black eye lucy, gene that interacts with fire.
everyone that answers emails or the phone at www.ms-reptilien.de can speak english very well, so you can just request the data you need translated or explained. You can also just copypaste here what you want translated and ill translate it for you right here, if its about the topic in question 
i didnt post images, i linked to the snakes for sale. The way the website is organized the larger images are only available embedded in some other code, which usually means they dont want people to download the images. A right-click is not enough, you need the sourcecode to download the images, or a screenshot. Its easy to hack by looking at the html sourcecode, so i *COULD* link or embed directly to the pictures here, but then i would make it easy for others to leech the images.
so, what is it? similar to something known, or is it something new? i mean, the gene ^^
-
-
for Sale in Germany: 100% het black eye lucy, gene that interacts with fire.
Wish I could tell you if it's new it's gorgeous tho I love what it seems to do to the patterns. I hope someone with more experience then me sees this!
Normals 1.3
Spider .1
Carpet Python .1
Dog APBT .1
-
-
They interact with fires becaues they are fires.... They are just their own line from Africa.
Stefan is an importer and goes to Africa himself and hand pics stuff.
Last edited by TessadasExotics; 03-25-2013 at 03:59 PM.
-
The Following 3 Users Say Thank You to TessadasExotics For This Useful Post:
Aes_Sidhe (03-26-2013),satomi325 (03-26-2013),snakesRkewl (03-25-2013)
-
I think the posts herein might help to answer your questions
http://www.reptileradio.net/ball-pyt...tml#post836546
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: for Sale in Germany: 100% het black eye lucy, gene that interacts with fire.
is there a gene known in the black-eye-lucy complex that, in the heterozygous form, does some kind of pattern reduction?
i mean, in contrast to fire, this gene doesnt seem to affect the color on its own, but maybe it does something to the pattern, the shapes seem to go a bit into the direction of enchi or mystic. I dont think its fire because i dont see it doing anything to color. Fire does something to the color, and alternate lines of fire are typically advertised as doing even more to the color.
basically im still waiting for the big deal breaker: someone coming along, showing that it looks similar to an already known gene in this gene complex, or showing that its similar to a known fire line. Otherwise, after a while, if we can agree that its new, we could move on to a different question... how should we call it? The guy named pinstripe, but wont name his own stuff.
-
-
Honestly I am not sure what you are looking at. Stefan is selling them as fires...... They look like fires to me and when bred to a known fire line they make a Black Eyed Lucy.
-
The Following 2 Users Say Thank You to TessadasExotics For This Useful Post:
Mike41793 (03-25-2013),satomi325 (03-26-2013)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|