Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,030

1 members and 1,029 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,928
Threads: 249,128
Posts: 2,572,274
Top Poster: JLC (31,651)
Welcome to our newest member, arushing027
Results 1 to 2 of 2

Thread: Free in atlanta

Threaded View

  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Free in atlanta

    If anyone in Atlanta wants some tanks I have a plethora of them I need to get rid of.

    6-10x 10 gallon tanks
    2x 20 gallon tanks
    1x 20 gallon long
    1x 35 gallon
    1x 3' x 2' x 2' all glass tank with wrought iron stand
    1x 4' x 3' x 2' acrylic tank with wood stand

    The latter two tanks have holes drilled in them for sump pumps but the holes can be easily patched up with plexi and silicon epoxy. This will not make them water tight but will eliminate the holes as escape routes.

    Email me at: asplundii (at) gmail (dot) com if you are interested. (I do not have a lot of time to be checking the boards so if you PM me I may not get your message.)

    After Jan 1st they go in the trash
    Last edited by asplundii; 12-27-2009 at 01:13 PM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1