» Site Navigation
4 members and 3,289 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,096
Threads: 248,538
Posts: 2,568,732
Top Poster: JLC (31,651)
|
-
Registered User
Energy Ball?
how do you make the energy ball....thanks
-
-
Re: Energy Ball?
I tried looking into it and... I got nothing... I'm gunna keep going.
Nope... I got nothing.
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
BPnet Veteran
Re: Energy Ball?
Lols...isn't that what Tai-Chi people do...make an "energy ball"? Or one of the characters from street fighter?!
I honestly have no idea, but I'd like to see it.
JonV
-
-
BPnet Veteran
Re: Energy Ball?
if you had a picture or description of what it looks like some people in here might be able to help
Cheers!
Mike,
Toronto Python Gurus.webs.com
BBM PIN: 21D7758C
-
-
Re: Energy Ball?
The ingrediants have not been released.
-
-
BPnet Veteran
Re: Energy Ball?
booooo! lol
Cheers!
Mike,
Toronto Python Gurus.webs.com
BBM PIN: 21D7758C
-
-
Re: Energy Ball?
Originally Posted by Python Guru
if you had a picture or description of what it looks like some people in here might be able to help
http://www.reptilegeeks.com/forums/d...thon-hatching/
To me it looks like some type of BEL clown
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Energy Ball?
im not expert when it comes to determining morphs but it looks like it definately has the lesser gene in there somewhere
Cheers!
Mike,
Toronto Python Gurus.webs.com
BBM PIN: 21D7758C
-
-
Registered User
Re: Energy Ball?
wow i wondering if he sold it...
-
-
BPnet Veteran
Re: Energy Ball?
it looks like a crystal lesser.
im guessing thats probally what it is since the crystal gene is a hidden gene.
and it reacts with lesser complex animals
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|