how do you make the energy ball....thanks
I tried looking into it and... I got nothing... I'm gunna keep going. Nope... I got nothing.
Ball Pythons 1.1 Lesser, Pastel 1.0 Lesser Pastel, 0.0.7 mixed babies
Lols...isn't that what Tai-Chi people do...make an "energy ball"? Or one of the characters from street fighter?! I honestly have no idea, but I'd like to see it. JonV
if you had a picture or description of what it looks like some people in here might be able to help
Cheers! Mike, Toronto Python Gurus.webs.com BBM PIN: 21D7758C
The ingrediants have not been released.
Heather Wong I AM the Wonginator Heather's Herps Website READ MY BLOG!!! Balls for Life, Baby!!!
booooo! lol
Originally Posted by Python Guru if you had a picture or description of what it looks like some people in here might be able to help http://www.reptilegeeks.com/forums/d...thon-hatching/ To me it looks like some type of BEL clown
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
im not expert when it comes to determining morphs but it looks like it definately has the lesser gene in there somewhere
wow i wondering if he sold it...
it looks like a crystal lesser. im guessing thats probally what it is since the crystal gene is a hidden gene. and it reacts with lesser complex animals
Forum Rules