heres a quick one what is the BOI and can that go on here?
1.0 husband 2.0 children * 1.1 doggies * 1.1 kitties * 0.1 dumerils boa * 1.0 argentine boa * 1.1 normal ball pythons * 1.0 normal kenyan boa * 0.1 anery kenyan boas * 1.0 tokay gecko * 1.0 russian tortoise * 1.0 beardie *
Posting that list was a great idea. I learned a new one today (dinker) & think it will help a lot of folks not familiar with reptile speak!
Originally Posted by crystal heres a quick one what is the BOI and can that go on here? The BOI is the Board of Inquiry here is the link to it http://www.faunaclassifieds.com/foru...splay.php?f=13
Deborah Stewart SOCIAL MEDIA
Added BOI to the list above.
-- Judy
Thought of another acronym that you might see around here: SVL - snout-to-vent length, the length of an animal measured from the tip of its snout to its vent (cloaca).
I would redo your definition of "het" because the way it is written sounds to me like you are talking about 2 different unrelated genes. I believe the prefered definition (at least among geneticists) is that a "het" is 2 different alleles of a specific gene.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Forgot an important one- BP- Ball python
- Matt Come here little guy. You're awfully cute and fluffy but unfortunately for you, you're made of meat
OP-Original Poster ...I didn't know what that one actually stood for FOREVER.
Hows about STP's short tailed pythons or if your a rock and roller stone temple pilots..
www.serpentim.com and like us on FB http://www.facebook.com/serpentim
Capray (10-18-2012),tsdsbd (07-17-2010)
is high contrast= H.C.?
Forum Rules