Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,647

0 members and 2,647 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,129
Threads: 248,573
Posts: 2,569,001
Top Poster: JLC (31,651)
Welcome to our newest member, KILLER112397
Page 2 of 2 FirstFirst 12
Results 11 to 12 of 12
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Possible risk to pet ferrets from COVID-19

    Quote Originally Posted by Bogertophis View Post
    especially since it's contradictory to what our CDC & USDA have said (see my post above), but keep in mind that some of our agencies have not been fully forthcoming either, esp. lately.
    As soon as the infected mink were discovered, scientists across the globe and the CDC said that the mink variants might pose a threat. So it is more than a little disingenuous to claim that they have not been forthcoming about it. There have also been genetic level analyses of the mink variants and, so far, none of them show any indication that they would undermine the efficacy of the vaccines. There are more than a few papers out there detailing all of this: Vet.Path., Nature, Science, Emerg.Infect.Dis., Journ.Transl.Med., Euro.Survell...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #12
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,318
    Thanks
    28,279
    Thanked 19,911 Times in 11,896 Posts

    Re: Possible risk to pet ferrets from COVID-19

    Quote Originally Posted by asplundii View Post
    As soon as the infected mink were discovered, scientists across the globe and the CDC said that the mink variants might pose a threat. So it is more than a little disingenuous to claim that they have not been forthcoming about it. There have also been genetic level analyses of the mink variants and, so far, none of them show any indication that they would undermine the efficacy of the vaccines. There are more than a few papers out there detailing all of this: Vet.Path., Nature, Science, Emerg.Infect.Dis., Journ.Transl.Med., Euro.Survell...
    I did not mean to imply that this was intentional, but obviously there HAS been some political tampering recently on some things, & also, things do change as more is learned. That's all I meant, thanks for your input.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1