Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,377

2 members and 3,375 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,095
Threads: 248,535
Posts: 2,568,714
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Page 1 of 2 12 LastLast
Results 1 to 10 of 11
  1. #1
    BPnet Veteran GpBp's Avatar
    Join Date
    06-14-2017
    Location
    Oklahoma
    Posts
    653
    Thanks
    649
    Thanked 290 Times in 180 Posts
    Images: 13

    Exclamation Fires! Worried about the animals...

    Hello! I hope I'm posting this in the right place! So, I live in central-ish Oklahoma, and there are huge wildfires in the northwestern areas of the state. They've already burned about 200,000+ acres, and they're still not really under control. Counties have already been evacuated, it's horrible. My area is under an extreme fire warning, and we have lots LOTS of smoke outside and a strong fire smell. I went outside to see (probably an hour and a half ago) and my throat hurt and my eyes watered, and I was outside for maybe 2 mins? My throat is still a little scratchy and I had to change clothes. So, I'm worried about the smell getting to the animals. You can't smell it as bad in the house, but it's still there. All I have in the animal room is a ceiling fan, so I have that on and the doors and windows closed. I have a bigger bag packed for the animals. If you don't know I have three snakes (two bps and one BCI) two crested geckos, and two guinea pigs. I have the snakes respective cloth bags out so I could put them in their bags and put the bags in a tub. Here's what I have packed in the big bag for everyone :

    • Almost a gallon of ReptiSafe purified water (In containers and in a mister)
    • The rest of my Reptisafe
    • Temp gun
    • Hand sanitizer
    • Matches
    • Money
    • A Sharpie
    • Gecko food
    • Guinea pig food
    • Water bottle for the guinea pigs
    • And some personal items

    What do you think of this? Sorry if this is in the wrong place, I just thought I'd share. Thanks!
    ¹.⁰ ᵖᵃˢᵗᵉˡ ᵇᵃˡˡ ᵖʸᵗʰᵒⁿ ⁻ ᵍᵉⁿᵒ
    ⁰.¹ ᶜᵒⁿᵈᵃ ʰᵒᵍⁿᵒˢᵉ ⁻ ᵏᵒᵛᵃ


    ¹.⁰ ᵖⁱⁿˢᵗʳⁱᵖᵉ ʰᵃʳˡᵉqᵘⁱⁿ ᶜʳᵉˢᵗᵉᵈ ᵍᵉᶜᵏᵒ ⁻ ᵖᵒᶜᵏᵉᵗ
    ¹.⁰ ᶠˡᵃᵐᵉ ᶜʳᵉˢᵗᵉᵈ ᵍᵉᶜᵏᵒ ⁻ ᵇᵉᵃ


  2. #2
    BPnet Lifer Sauzo's Avatar
    Join Date
    11-26-2014
    Location
    Seattle Washington
    Posts
    6,011
    Thanks
    2,064
    Thanked 6,341 Times in 3,220 Posts
    You can probably ditch the water as you can just buy bottled water for the animals and you wouldnt need reptisafe for it. Now as for purified water, i have been trying to research it as it got me interested not only with humans but with animals. From what I have gathered in my relatively short time of research, distilled water is not good for long term drinking. It will raise your bodies acidity. Purified water isnt the best either as generally has most or all of the trace elements removed from it. Spring water they say is probably the best as it has trace elements in it from the bedrock and stuff as it comes from underground springs. They purify it will UV to kill bacteria it can contain like giardia, ecoli and stuff. Also i have noticed purified water has a weird noticeable taste to it where as spring water doesnt have any taste.

    I have decided to do a test and have bought my snakes bottled spring water and am going to try it for a year and see if i notice a difference. Sorry for going off topic but the thing just popped into my head when i saw purified water lol.

    But anyways. best of luck and hope the fire avoids you. Fingers crossed man.

    Also i would pack some tubs to act as caging for the snakes as well as a UTH and have either a cheapo t-stat packed or have an extra probe packed for your good t-stat in case you have to leave quick and can just grab the t-stat unit and the plug wire.

    And dont forget the biggest essentials, a firearm or 6 and plenty of ammo as well as blankets.
    Last edited by Sauzo; 04-13-2018 at 11:34 PM.
    0.1 Rio Bravo Pokigron Suriname BC-Gina
    1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie

    0.1 Biak Green Tree Python-Pat
    ​1.0 OSHY Biak Green Tree Python-Alex
    0.0.1 Super Reduced Reticulated Gila Monster-Dozer
    0.0.1 Utah Banded Gila Monster-Tank
    0.0.1 Super Black Beaded Lizard-Reggie

  3. The Following User Says Thank You to Sauzo For This Useful Post:

    C.Marie (04-14-2018)

  4. #3
    BPnet Veteran GpBp's Avatar
    Join Date
    06-14-2017
    Location
    Oklahoma
    Posts
    653
    Thanks
    649
    Thanked 290 Times in 180 Posts
    Images: 13

    Re: Fires! Worried about the animals...

    Quote Originally Posted by Sauzo View Post
    You can probably ditch the water as you can just buy bottled water for the animals and you wouldnt need reptisafe for it. Now as for purified water, i have been trying to research it as it got me interested not only with humans but with animals. From what I have gathered in my relatively short time of research, distilled water is not good for long term drinking. It will raise your bodies acidity. Purified water isnt the best either as generally has most or all of the trace elements removed from it. Spring water they say is probably the best as it has trace elements in it from the bedrock and stuff as it comes from underground springs. They purify it will UV to kill bacteria it can contain like giardia, ecoli and stuff. Also i have noticed purified water has a weird noticeable taste to it where as spring water doesnt have any taste.

    I have decided to do a test and have bought my snakes bottled spring water and am going to try it for a year and see if i notice a difference. Sorry for going off topic but the thing just popped into my head when i saw purified water lol.

    But anyways. best of luck and hope the fire avoids you. Fingers crossed man.

    Also i would pack some tubs to act as caging for the snakes as well as a UTH and have either a cheapo t-stat packed or have an extra probe packed for your good t-stat in case you have to leave quick and can just grab the t-stat unit and the plug wire.

    And dont forget the biggest essentials, a firearm or 6 and plenty of ammo as well as blankets.
    Thanks Sauzo! I'll keep the ReptiSafe this time if you think that's fine, just because I have a lot packed lol. I don't have any distilled/purified/spring water at my house, we just use a Brita But I will keep this in mind! I'm hopeful too, strong winds but luckily blowing past us. Still very dry here though.
    I'll pack some tubs for sure! I don't have an extra UTH though... I could pack some hot hands?
    ¹.⁰ ᵖᵃˢᵗᵉˡ ᵇᵃˡˡ ᵖʸᵗʰᵒⁿ ⁻ ᵍᵉⁿᵒ
    ⁰.¹ ᶜᵒⁿᵈᵃ ʰᵒᵍⁿᵒˢᵉ ⁻ ᵏᵒᵛᵃ


    ¹.⁰ ᵖⁱⁿˢᵗʳⁱᵖᵉ ʰᵃʳˡᵉqᵘⁱⁿ ᶜʳᵉˢᵗᵉᵈ ᵍᵉᶜᵏᵒ ⁻ ᵖᵒᶜᵏᵉᵗ
    ¹.⁰ ᶠˡᵃᵐᵉ ᶜʳᵉˢᵗᵉᵈ ᵍᵉᶜᵏᵒ ⁻ ᵇᵉᵃ


  5. The Following User Says Thank You to GpBp For This Useful Post:

    zina10 (04-16-2018)

  6. #4
    bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,502
    Thanks
    2,891
    Thanked 9,859 Times in 4,779 Posts
    Images: 34
    I would pre-pack as much stuff in my car as I could. My understanding when you are forced to evacuate for a fire is that you may only be given a few minutes to run.

    Don't forget to have important documents like birth certificate, passport, vehicle titles, house deeds, etc. ready to go at a moment's notice as well.

    Do you have somewhere safe to go that will accept you and your animals? Pets are not permitted in shelters.

  7. The Following 3 Users Say Thank You to bcr229 For This Useful Post:

    Reinz (04-14-2018),Timelugia (04-16-2018),zina10 (04-16-2018)

  8. #5
    BPnet Lifer Sauzo's Avatar
    Join Date
    11-26-2014
    Location
    Seattle Washington
    Posts
    6,011
    Thanks
    2,064
    Thanked 6,341 Times in 3,220 Posts

    Re: Fires! Worried about the animals...

    Quote Originally Posted by GpBp View Post
    Thanks Sauzo! I'll keep the ReptiSafe this time if you think that's fine, just because I have a lot packed lol. I don't have any distilled/purified/spring water at my house, we just use a Brita But I will keep this in mind! I'm hopeful too, strong winds but luckily blowing past us. Still very dry here though.
    I'll pack some tubs for sure! I don't have an extra UTH though... I could pack some hot hands?
    You can use hot hands but they tend to get really hot so you would want to stuff them in something like a sock and wrap it up to kind of lessen the heat intensity. I personally have a stack of 40 hour UniHeats next to my snake cages if i have a power outage. Those plus a Mr Heater Big Buddy and you are good for days with no power.
    0.1 Rio Bravo Pokigron Suriname BC-Gina
    1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie

    0.1 Biak Green Tree Python-Pat
    ​1.0 OSHY Biak Green Tree Python-Alex
    0.0.1 Super Reduced Reticulated Gila Monster-Dozer
    0.0.1 Utah Banded Gila Monster-Tank
    0.0.1 Super Black Beaded Lizard-Reggie

  9. The Following User Says Thank You to Sauzo For This Useful Post:

    GpBp (04-14-2018)

  10. #6
    BPnet Veteran GpBp's Avatar
    Join Date
    06-14-2017
    Location
    Oklahoma
    Posts
    653
    Thanks
    649
    Thanked 290 Times in 180 Posts
    Images: 13

    Re: Fires! Worried about the animals...

    Quote Originally Posted by bcr229 View Post
    I would pre-pack as much stuff in my car as I could. My understanding when you are forced to evacuate for a fire is that you may only be given a few minutes to run.

    Don't forget to have important documents like birth certificate, passport, vehicle titles, house deeds, etc. ready to go at a moment's notice as well.

    Do you have somewhere safe to go that will accept you and your animals? Pets are not permitted in shelters.
    Thanks! I've packed even more now lol, blankets, pillows, my violin I'm trying to stay calm about it lol. And yes, we've packed the important stuff too. I've been watching the news, and still, the only big fires are in the southwestern area. But, the conditions are just right in my town that even a spark could cause something big! Guess whos not sleeping tonight (today? it's almost 1am lol)! Time to keep my phone near and start a new TV show But seriously, I'm watching and I think I'm ready if anything were to happen. Also, we'd probably go to Tulsa (2 and a half hours away) where family is.

    Looked out the window and thought I saw flames. Was about to call 911 when I realized it was a streetlight
    ¹.⁰ ᵖᵃˢᵗᵉˡ ᵇᵃˡˡ ᵖʸᵗʰᵒⁿ ⁻ ᵍᵉⁿᵒ
    ⁰.¹ ᶜᵒⁿᵈᵃ ʰᵒᵍⁿᵒˢᵉ ⁻ ᵏᵒᵛᵃ


    ¹.⁰ ᵖⁱⁿˢᵗʳⁱᵖᵉ ʰᵃʳˡᵉqᵘⁱⁿ ᶜʳᵉˢᵗᵉᵈ ᵍᵉᶜᵏᵒ ⁻ ᵖᵒᶜᵏᵉᵗ
    ¹.⁰ ᶠˡᵃᵐᵉ ᶜʳᵉˢᵗᵉᵈ ᵍᵉᶜᵏᵒ ⁻ ᵇᵉᵃ


  11. #7
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22

    Re: Fires! Worried about the animals...

    just popping in to say good luck!!! please stay safe!
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  12. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    MPR did an episode a little while back on a guy who had to evac a couple times during the CA fires, you might want to try tracking that down and giving it a listen to as he details all kinds of things he learned from the experience.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. #9
    Venom Life Neal's Avatar
    Join Date
    11-23-2008
    Location
    Louisiana
    Posts
    7,084
    Thanks
    601
    Thanked 2,140 Times in 1,556 Posts
    Blog Entries
    8
    Images: 1
    Sorry to hear about your situation. I hope they're able to get it under control and you're safe. I have family in Norman and Noble Oklahoma.
    -Venomous-

    1.0 - Naja siamensis - Zeus (Black & White Spitting Cobra)
    1.0 - Naja n. woodi - Hades (Black Spitting Cobra)
    0.1 - Naja nigricollis - Athena (Black-necked Spitting Cobra)

    coming at some point in the future
    Naja annulata (Ringed Water Cobra)




  14. #10
    BPnet Lifer zina10's Avatar
    Join Date
    08-09-2010
    Location
    southeast
    Posts
    4,573
    Thanks
    5,693
    Thanked 6,185 Times in 2,610 Posts
    Any news ??

    I feel bad for you, it is horrible to face this. I've been in this situation twice, and more often I had to watch carefully in order to be ready if need be. For me it was hurricanes. In a way its the same, destructive and you watch as it approaches slowly, never knowing until its almost on top of you which way it will go.

    Its stressful enough as it is to face loosing everything, but with animals and having to pack their stuff, its even more stressful.

    Pre Packing whatever you need is so important. There just isn't time when it gets bad. I have started to keep all the important paperwork and other important things in my safe. It keeps it safe at my house, but its also already in one place to grab if needed.

    Aside from that? A couple changes of clothes for everyone, small containers for the animals. Prepared tubs. At least one thermostat and a couple of thermometers. You can buy a human heat pad in a pinch, one that doesn't shut off automatically, but you will need a thermostat or, in a pinch, have a heat pad with settings, set it on lowest and KEEP EYE ON IT.
    In a bad situation you have to make the best out of what you have. Getting a bit cold is always safer then getting to hot, when it comes to reptiles.

    Keep the vehicles gassed up 100%. Keep some drinking water and non perishable food/snacks in car. Blankets if nights get cold. I've had to sleep in the car before during an evacuation. Have cash on hand. And yes, if you have some, bring a gun. If you go to a hotel, don't tell them about the reptiles, just smuggle them in.
    Zina

    0.1 Super Emperor Pinstripe Ball Python "Sunny"
    0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna"
    0.1 Pastel Desert Ghost Ball Python "Arjanam"
    0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora"
    0.1 Pastel Enchi Desert Ghost Ball Python "Venus"
    1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius"
    1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"

    "It is only with the heart that one can see rightly; what is essential is invisible to the eye."
    - Antoine de Saint-ExupÈry

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1