» Site Navigation
1 members and 811 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,069
Threads: 249,219
Posts: 2,572,796
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: recessive, co-dom, dominate
It's like back in elementry school with the times tables! The fives are easy, and there are tricks for the nines, but most of them you just have to memorize.
-
-
Re: recessive, co-dom, dominate
 Originally Posted by rocky88
No I'm not really looking for a list. I just want to be able to tell which ones are recessive, co-dom etc... All of you experienced bp people, if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc..... How do you know if it is recessive or co-dom, dom? Did you just learn to kinda memorize which are which and now it's just second nature. Or is there some kind of method behind knowing???? Sorry if I am confusing you and you cant figure out what I'm asking. I'm just so confused on the subject  
Yes, you just start to learn it over time. Your list above:
recessive, dominant, recessive, recessive, recessive, co-dominant, dominant
It's just spending lots of times on breeder's websites, getting books, going to Ralph's and NERD's sites which will tell you if a morph is recessive, dominate, co-dom.
It does become second nature.
-
-
BPnet Veteran
Re: recessive, co-dom, dominate
another great recource,is SBP's site,which in his forums,he has photos and genetics of pretty much all the morphs,who created them,and genetics behind them,including combos
1.0 blonde pastel,1.8 normal,1.1 het orange ghost 1.0 het butterscotch 0.1 het green ghost 0.1 het albino 0.1 rtb 0.1 yellow anaconda 1.0 borneo blood 1.0 albino burmese
-
-
Re: recessive, co-dom, dominate
 Originally Posted by rocky88
if I came to you and said what is a clown or what is a spider or what is an albino, axanthic, piebald, pastel, normal, etc.....
 Originally Posted by rabernet
Your list above:
recessive, dominant, recessive, recessive, recessive, co-dominant, dominant
Robin, if I am interpreting your answer correctly, you are stating that normal is dominant. This is not true.
There are 2 things one needs to understand. First of all, clown, spider, and all the rest of the base morphs (not normal), refer to a single mutated gene. It may or may not require a pair to be visual, but it is just 2 copies of the same gene. Combos are obviously a different story, because they require more than one mutated gene. What many people do not realize is that normal is also a very different story. "Normal" actually refers to quite a few different genes, one normal gene on the clown locus, one different normal gene on the spider locus, yet another different gene on the albino locus, etc.
Also, one should understand that genes are only dominant or recessive in relationship to other genes. I am not aware of any genes that work this way in BPs, but in corns, amelanistic is recessive compared to the normal gene on that locus. There is another gene, ultra, that is on the same locus. Ultra is also recessive compared to normal. However, amel and ultra are co-dominant to each other, and if you have a snake that has one of each, you get an ultramel. Most people will still say that amel (or ultra) is recessive, but that is not true in relationship to each other. In fact, it is impossible for them both to be recessive to each other.
So, getting back to normal in BPs, whether normal is recessive, dominant, or co-dom depends on which normal gene you are referring to, and which mutated gene you are comparing it to. The normal gene on the clown locus is dominant to clown, but the normal gene on the spider locus is recessive to spider, and the normal gene on the pastel locus is co-dominant to pastel.
-
-
Re: recessive, co-dom, dominate
 Originally Posted by RebelYell83
another great recource,is SBP's site,which in his forums,he has photos and genetics of pretty much all the morphs,who created them,and genetics behind them,including combos
Can you provide a link?
-
-
Re: recessive, co-dom, dominate
 Originally Posted by kc261
Also, one should understand that genes are only dominant or recessive in relationship to other genes. I am not aware of any genes that work this way in BPs, but in corns, amelanistic is recessive compared to the normal gene on that locus. There is another gene, ultra, that is on the same locus. Ultra is also recessive compared to normal. However, amel and ultra are co-dominant to each other, and if you have a snake that has one of each, you get an ultramel. Most people will still say that amel (or ultra) is recessive, but that is not true in relationship to each other. In fact, it is impossible for them both to be recessive to each other.
Actually the ultra and the amel are recessive because convention is the relationship of the mutant to the wild type (i.e. normal). Ultra and amel are recessive to the WT whether in homozygous or heterozygous pair. In terms of relationship to one another, ultra and amel are simply alternate alleles (which are indeed co-expressive). The closest example of this in BPs would be the BluEL complex or YB/Whirwind or Cinny/Black Pastel. In each of these the mutants are inc-dom to WT but allelic to the others within the group (i.e. Butter is allelic to Lesser is allelic to Mojave is allelic to Phantom is allelic to Russo.)
So, getting back to normal in BPs, whether normal is recessive, dominant, or co-dom depends on which normal gene you are referring to, and which mutated gene you are comparing it to. The normal gene on the clown locus is dominant to clown, but the normal gene on the spider locus is recessive to spider, and the normal gene on the pastel locus is co-dominant to pastel.
Wild type is neither recessive nor dominant nor co-dom. It is just a baseline by which mutations are measured against.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: recessive, co-dom, dominate
 Originally Posted by asplundii
Actually the ultra and the amel are recessive because convention is the relationship of the mutant to the wild type (i.e. normal). Ultra and amel are recessive to the WT whether in homozygous or heterozygous pair. In terms of relationship to one another, ultra and amel are simply alternate alleles (which are indeed co-expressive). The closest example of this in BPs would be the BluEL complex or YB/Whirwind or Cinny/Black Pastel. In each of these the mutants are inc-dom to WT but allelic to the others within the group (i.e. Butter is allelic to Lesser is allelic to Mojave is allelic to Phantom is allelic to Russo.)
Wild type is neither recessive nor dominant nor co-dom. It is just a baseline by which mutations are measured against.
Hmmm. That is different than what I was taught in college. At least it is different than how I remember it; it was quite a few years ago. 
Do you happen to have any sources where I could study it and make sure I understand it properly?
-
-
Re: recessive, co-dom, dominate
 Originally Posted by kc261
Hmmm. That is different than what I was taught in college. At least it is different than how I remember it; it was quite a few years ago. 
I would be more inclined to think it is more down to your Prof not being able to make the explanation clear. It is kind of a slippery thing to describe.
Think of it this way; You are in the bottom of a well. Are you above or below?
Most people just say you are "below" because they assume a default state where ground level is the baseline/reference point. The correct answer, however, is that the question as asked, without a reference point given, can not be answered. "Below" would be correct if you are using ground level as a reference but if you are using the center of the earth as a reference then you would be "above". Make sense?
So it is with genetic relation. WT is the reference by which we judge whether a mutation is recessive, dominant or co-dom.
Let us look at Pinstripe as an example. When an animal is carrying the mutant gene (be they heterozygous or homozygous for the condition) it appears different than the WT and it only takes one copy of the gene to bring this phenotype about. So Pin is dominant to WT. We do not say that WT is recessive to Pin because Pin is not the normal state of these animals. That is usually the point that catches people. It is true that the WT allele is recessive to the Pin allele but it is the WT allele that is the reference point by which we are judging the animal, not the mutant allele.
Do you happen to have any sources where I could study it and make sure I understand it properly?
Not off hand, just going off my old texts and classes and my day to day work. If you want I can dig up a specific text.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: recessive, co-dom, dominate
[QUOTE=asplundii;1043204]
Think of it this way; You are in the bottom of a well. Are you above or below?
Most people just say you are "below" because they assume a default state where ground level is the baseline/reference point. The correct answer, however, is that the question as asked, without a reference point given, can not be answered. "Below" would be correct if you are using ground level as a reference but if you are using the center of the earth as a reference then you would be "above". Make sense?
[/I can QUOTE]
Why would you use the center of the Earth as a reference point? It is impossible to be below the center of the Earth when you consider gravitational pull and that apart from gravity, there is no up, above, below, or under.
The reference points (in relation to above or under), would be typical ground level, sea level, or the floor of the well as a modified ground level. Could it then be in relation to the level of the water?
Haha, this is quite off the original topic.
-Steven
-Steven
-
-
BPnet Veteran
Re: recessive, co-dom, dominate
 Originally Posted by asplundii
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
OK, I did a BLASTn and this sequence is fairly homologous to several genes in any number of creatures from humans to zebrafish to rice and a fair number of beasties in between. And asplundii is the species name for several different botanical forms. So spill, 'cause it's driving me crazy. What's the sequence?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|