» Site Navigation
3 members and 3,379 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,535
Posts: 2,568,714
Top Poster: JLC (31,651)
|
-
-
-
BPnet Veteran
Re: Some hidden gene woma stuff post shed...
Nice........that female is killer.
-
-
Registered User
Re: Some hidden gene woma stuff post shed...
wow they are awesome..the eye on third bP looks amazing
A gemstone cannot be polished without friction, nor a man perfected without trials. CONFUCIUS
1.0 Normal Royal Python (mr Zola)
0.1 Ghost pos het Caramel Albino (Kes)
1.0 Spider (Peek)
0.1 Citrus Pastel (Sirius)
1.0 YellowBelly (Haku)
-
-
Registered User
Re: Some hidden gene woma stuff post shed...
Your snakes are amazing! Could you demystify for me how to know that a snake has the hidden gene?
-
-
BPnet Veteran
Re: Some hidden gene woma stuff post shed...
That last one (the yb woma + hg) is stunning
Now you really need to put those with a lesser for soul-sucker
-
-
Re: Some hidden gene woma stuff post shed...
Originally Posted by AleXtreme Reptiles
Could you demystify for me how to know that a snake has the hidden gene?
Odds are that that specific animal does not carry the hidden gene. There was a really long discussion on this matter here:
http://www.reptileradio.net/reptiler...ead.php?t=9389
Originally Posted by Watever
Now you really need to put those with a lesser for soul-sucker
Not that easy I am afraid. Check out the link above, it covered that as well
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: Some hidden gene woma stuff post shed...
Yup...the hidden gene to me is just a name associated with the morph itself.
The woma ball and the 'Hidden gene' woma ball are two completely different morphs so when you see a normal woma ball that sells for a few hundred dollars it has nothing to do with what I have posted here. Think of the 'hidden gene' woma as the NERD ball or any other name besides one currently used.
-
The Following User Says Thank You to The Cleaner For This Useful Post:
-
BPnet Veteran
Re: Some hidden gene woma stuff post shed...
Originally Posted by Spaniard
Woah mamma, those are nice
And thus the name!
Great looking snakes, particularly the girlie. Congrats!
~~ZinniaZ
2.1.0 ball python-- James Herriot the Spider BP and Paradox, my son's female normal BP, Jack London, het red axanthic
0.1 Blue Beauty-- Anna Sewall
-
-
Registered User
Re: Some hidden gene woma stuff post shed...
Thanks to both of you, "asplundii" and "The Cleaner". It helped me to demistify the "hidden gene" thing.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|