Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 354

15 members and 339 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 64,010
Threads: 238,110
Posts: 2,473,326
Top Poster: JLC (31,652)
Welcome to our newest member, Mule 66
Page 4 of 17 FirstFirst 1234567891011121314 ... LastLast
Results 31 to 40 of 169
  1. #31
    BPnet Veteran OhBalls's Avatar
    Join Date
    01-21-2008
    Location
    Massachusetts
    Posts
    910
    Thanks
    209
    Thanked 277 Times in 107 Posts
    Images: 9

    Re: DIY Home-made "realistic" Hides

    Quote Originally Posted by PythonWallace View Post
    NIce tutorial, but is the clay water resistant to the point hat these can be washed? If not, fino or something might work beter. Someone also asked about using an existing stone hide as a base. You can get a mold makiong kit or fill the interior cavity with a latex filler, then pull it out and use it for your base. You can just shape the outside to match, or you can make a plaster mold of the outside and press it down on top of the clay once it's formed on the base. You'd have exact replicas with a litle more work.
    No, the clay itself is not waterproof, which is why there are two waterproofing steps. Once before the paint and once after. Though, I would not suggest letting them soak in water, giving them a wash won't hurt since they are waterproofed. They're inexpensive enough that even if the person does NOT waterproof enough to make them completely sealed, it's not a big loss cost wise.
    I have a resin kit that I was going to use, but I read some other DIY's where people were looking for an inexpensive solution. So the point of this DIY was to keep costs at a minimum and make it easy enough for even kids to make.
    I think that by the time you bought Fimo, latex or even plaster, with all the other sealing and painting...it would be more cost effective to simply buy a store bought hide.
    Again, if you have the money and want the satisfaction of building it yourself, by all means, go for it...I am sure your ideas would make some killer hides! Thanks for the ideas!

  2. #32
    BPnet Senior Member BMorrison's Avatar
    Join Date
    01-31-2008
    Location
    Nashville, Tennessee
    Posts
    1,820
    Thanks
    479
    Thanked 491 Times in 300 Posts
    Images: 12

    Re: DIY Home-made "realistic" Hides

    That is beautiful. Thank you!

    Facebook.com/ToValhallaReptiles
    Instagram.com/ToValhallaReptiles

  3. #33
    BPnet Veteran PythonWallace's Avatar
    Join Date
    02-26-2007
    Location
    Woodridge, IL
    Posts
    2,967
    Thanks
    204
    Thanked 345 Times in 209 Posts
    Images: 23

    Re: DIY Home-made "realistic" Hides

    Quote Originally Posted by OhBalls View Post
    No, the clay itself is not waterproof, which is why there are two waterproofing steps. Once before the paint and once after. Though, I would not suggest letting them soak in water, giving them a wash won't hurt since they are waterproofed. They're inexpensive enough that even if the person does NOT waterproof enough to make them completely sealed, it's not a big loss cost wise.
    I have a resin kit that I was going to use, but I read some other DIY's where people were looking for an inexpensive solution. So the point of this DIY was to keep costs at a minimum and make it easy enough for even kids to make.
    I think that by the time you bought Fimo, latex or even plaster, with all the other sealing and painting...it would be more cost effective to simply buy a store bought hide.
    Again, if you have the money and want the satisfaction of building it yourself, by all means, go for it...I am sure your ideas would make some killer hides! Thanks for the ideas!
    I hear you. I didn't catch that you waterproof the inside as well. I was just letting the other poster know what would be involved in using a store bought hide as your mold, but I agree it would be cheaper to just buy another one. Again, nice write up!
    What are these mojavas I keep hearing so much about?

    J. W. Exotics

    Reptile Incubators

  4. #34
    BPnet Veteran OhBalls's Avatar
    Join Date
    01-21-2008
    Location
    Massachusetts
    Posts
    910
    Thanks
    209
    Thanked 277 Times in 107 Posts
    Images: 9

    Re: DIY Home-made "realistic" Hides

    Quote Originally Posted by V1L3 DiaL3cT View Post
    That is beautiful. Thank you!
    Thanks!

    I'm in the process of making several more, adding different decoration ideas to each.
    If anyone has anything they would like to add for ideas on decorating them, please let me know! I'll post pics of the finished results with how-to's if anyone is interested!

  5. The Following User Says Thank You to OhBalls For This Useful Post:

    FloridaHogs (10-27-2008)

  6. #35
    BPnet Veteran FloridaHogs's Avatar
    Join Date
    08-01-2005
    Location
    Pensacola, FL
    Posts
    344
    Thanks
    43
    Thanked 30 Times in 23 Posts
    Images: 2

    Re: DIY Home-made "realistic" Hides

    Yes, please post pics of your finished products!
    Jenea
    GuardianReptiles.com

    "The irrational fear of snakes is the only excuse a grown man has to act like a complete sissy" - Colchicine

  7. #36
    BPnet Veteran OhBalls's Avatar
    Join Date
    01-21-2008
    Location
    Massachusetts
    Posts
    910
    Thanks
    209
    Thanked 277 Times in 107 Posts
    Images: 9

    Re: DIY Home-made "realistic" Hides

    Decoration idea....not the most practical for tubs, but looks neat in a display tank.

    Fall Themed Hide


    Everything is tacked onto the hide with hot glue for easy removal (except the rocks)

  8. The Following 2 Users Say Thank You to OhBalls For This Useful Post:

    Ana Maria (02-07-2017),LadyWraith (07-22-2012)

  9. #37
    BPnet Veteran Beardedragon's Avatar
    Join Date
    11-11-2007
    Location
    Kennesaw GA
    Posts
    4,199
    Thanks
    535
    Thanked 460 Times in 334 Posts
    Images: 21

    Re: DIY Home-made "realistic" Hides

    cleaning that will be fun Its nice though, there is so much I could do to with this clay.
    - Matt

    Come here little guy. You're awfully cute and fluffy but unfortunately for you, you're made of meat

  10. #38
    BPnet Veteran Drew87's Avatar
    Join Date
    12-20-2007
    Location
    phoenix, AZ
    Posts
    2,450
    Thanks
    420
    Thanked 293 Times in 288 Posts
    Images: 38

    Re: DIY Home-made "realistic" Hides

    Really cool idea, ill have to give that a try.

  11. #39
    BPnet Veteran Patrick Long's Avatar
    Join Date
    02-16-2005
    Location
    Ventura, California, United States
    Posts
    8,211
    Thanks
    564
    Thanked 987 Times in 736 Posts
    Images: 36

    Re: DIY Home-made "realistic" Hides

    Got it workin!!!!


    I think my old flour didnt hold the moisture very well, I ended up using about half the water.

  12. #40
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    745
    Thanks
    74
    Thanked 500 Times in 278 Posts

    Re: DIY Home-made "realistic" Hides

    Interesting idea.

    Here is a link that may be of interest too.

    http://www.dendroboard.com/forum/par...ake-rocks.html

    It is 25 pages long so be ready to read but the best info is by the member HX starting about page 3. I think theis method could probably be modified to make hides in a similar manner, by casting over a bowl or the like. And you do not need to worry about water proofing afterwards...

    Anyways, just a reference if others are interested.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 4 of 17 FirstFirst 1234567891011121314 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1