Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 320

4 members and 316 guests
Most users ever online was 3,642, 05-08-2016 at 09:50 AM.


» Today's Birthdays

Mittens (31)

» Stats

Members: 62,730
Threads: 235,982
Posts: 2,445,357
Top Poster: JLC (31,652)
Welcome to our newest member, carin
Page 3 of 4 FirstFirst 1234 LastLast
Results 21 to 30 of 37
  1. #21
    BPnet Veteran crystal's Avatar
    Join Date
    06-17-2008
    Location
    Spokane Wa
    Posts
    261
    Thanks
    2
    Thanked 2 Times in 2 Posts
    Images: 21

    Re: What does that mean? Herp abbreviations & acronyms

    heres a quick one
    what is the BOI
    and can that go on here?
    1.0 husband 2.0 children * 1.1 doggies * 1.1 kitties * 0.1 dumerils boa * 1.0 argentine boa * 1.1 normal ball pythons * 1.0 normal kenyan boa * 0.1 anery kenyan boas * 1.0 tokay gecko * 1.0 russian tortoise * 1.0 beardie *


  2. #22
    New Member
    Join Date
    03-19-2008
    Location
    Florida
    Posts
    22
    Thanks
    2
    Thanked 0 Times in 0 Posts

    Thumbs up Re: What does that mean? Herp abbreviations & acronyms

    Posting that list was a great idea. I learned a new one today (dinker) & think it will help a lot of folks not familiar with reptile speak!

  3. #23
    Telling it like it is! Deborah's Avatar
    Join Date
    09-28-2006
    Posts
    23,192
    Thanks
    5,707
    Thanked 17,477 Times in 8,347 Posts
    Blog Entries
    1
    Images: 5

    Re: What does that mean? Herp abbreviations & acronyms

    Quote Originally Posted by crystal View Post
    heres a quick one
    what is the BOI
    and can that go on here?
    The BOI is the Board of Inquiry here is the link to it http://www.faunaclassifieds.com/foru...splay.php?f=13

  4. #24
    Don't Push My Buttons JLC's Avatar
    Join Date
    01-28-2004
    Location
    Alexandria, VA
    Posts
    31,652
    Thanks
    3,195
    Thanked 7,095 Times in 3,025 Posts
    Blog Entries
    37
    Images: 304

    Re: What does that mean? Herp abbreviations & acronyms

    Added BOI to the list above.
    -- Judy

  5. #25
    BPnet Veteran icygirl's Avatar
    Join Date
    07-02-2007
    Location
    Mass.
    Posts
    1,439
    Thanks
    186
    Thanked 139 Times in 117 Posts
    Images: 11

    Re: What does that mean? Herp abbreviations & acronyms

    Thought of another acronym that you might see around here:

    SVL - snout-to-vent length, the length of an animal measured from the tip of its snout to its vent (cloaca).

  6. #26
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    701
    Thanks
    69
    Thanked 467 Times in 253 Posts

    Re: What does that mean? Herp abbreviations & acronyms

    I would redo your definition of "het" because the way it is written sounds to me like you are talking about 2 different unrelated genes.

    I believe the prefered definition (at least among geneticists) is that a "het" is 2 different alleles of a specific gene.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #27
    BPnet Veteran Beardedragon's Avatar
    Join Date
    11-11-2007
    Location
    Kennesaw GA
    Posts
    4,199
    Thanks
    535
    Thanked 460 Times in 334 Posts
    Images: 21

    Re: What does that mean? Herp abbreviations & acronyms

    Forgot an important one- BP- Ball python
    - Matt

    Come here little guy. You're awfully cute and fluffy but unfortunately for you, you're made of meat

  8. #28
    BPnet Veteran Aeries's Avatar
    Join Date
    11-05-2008
    Location
    Canada
    Posts
    346
    Thanks
    9
    Thanked 54 Times in 46 Posts
    Images: 4

    Re: What does that mean? Herp abbreviations & acronyms

    OP-Original Poster

    ...I didn't know what that one actually stood for FOREVER.

  9. #29
    BPnet Veteran Tim Mead's Avatar
    Join Date
    01-09-2010
    Location
    Oklahoma
    Posts
    623
    Thanks
    246
    Thanked 308 Times in 216 Posts
    Images: 20

    Re: What does that mean? Herp abbreviations & acronyms

    Hows about STP's short tailed pythons or if your a rock and roller
    stone temple pilots..

  10. The Following 2 Users Say Thank You to Tim Mead For This Useful Post:

    Capray (10-18-2012),tsdsbd (07-17-2010)

  11. #30
    Registered User JeffD's Avatar
    Join Date
    02-05-2010
    Location
    Georgia USA
    Posts
    136
    Thanks
    20
    Thanked 37 Times in 37 Posts
    Images: 23

    Talking Re: What does that mean? Herp abbreviations & acronyms

    is high contrast= H.C.?

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1