Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,872

0 members and 2,872 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,087
Threads: 248,528
Posts: 2,568,676
Top Poster: JLC (31,651)
Welcome to our newest member, FayeZero
Page 1 of 3 123 LastLast
Results 1 to 10 of 22
  1. #1
    Registered User
    Join Date
    05-11-2021
    Posts
    2
    Thanks
    2
    Thanked 3 Times in 1 Post

    My Ball Python tested positive for Nidovirus

    The title says it all.
    My first snake was a corn snake, who I’ve had for the past 6 months. I’ve always wanted a Royal Python, and researched them for years. I finally took the plunge and bought Buddy, who was perfect when I first bought him home. He’s a stunning low white pied with a lovely temperament, I was over the moon.

    He was great for the first 2 weeks, he ate for me twice. Then out of the blue, he stopped eating. I tried to leave him be, knowing this is common in royals. Then after a month of not eating, I noticed he had a bubbly mouth. I knew this must’ve been an RI, so took him to the vets the very next day. Upon talking through my vivarium, temps and humidity, the vets said they seemed to be good. The vets took swabs and blood work from Buddy but said it would take a week or so to get results. They gave me antibiotic injections to give him daily, and nebulise him twice a day which I have been doing for the past 10 days.

    However, today I received my results back. Buddy tested positive for Nidovirus. I didn’t know what this was at first, but upon researching it a bit I realised the fatality and I am absolutely heartbroken. He came from a big breeder so I will definitely provide them with the results, but I’m not sure what they’ll say about this. I have never seen a bad review against this breeder, which makes me very confused with how my snake can have Nidovirus but no one else (that I can see) has experienced this? I also checked reviews for my corn snake’s breeder and I’m met with the same thing. All positive reviews.

    I’ve kept Buddy completely quarantined from my corn snake, and have been careful, I assume Nidovirus affects all snakes, however I can’t find much information on it. I don’t know if my corn snake has it, and whether I can even get him tested as it can lie dormant in them.
    I am heartbroken, as I’m sure I will have to get Buddy euthanised as there is no cure. I just wanted to share this here as I can find very little information on it. Has anyone else had any Nidovirus experiences? I can’t possibly see how it can be preventable which is so upsetting.
    Last edited by Bogertophis; 05-21-2021 at 05:04 PM. Reason: spaces added to make post easier to read

  2. The Following 3 Users Say Thank You to BuddyK For This Useful Post:

    Albert Clark (08-30-2022),Bogertophis (05-21-2021),Malum Argenteum (08-31-2022)

  3. #2
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,243
    Thanks
    28,153
    Thanked 19,816 Times in 11,840 Posts
    I'm so sorry for your sad situation. I have no personal experience with this, just wanted to share this, not knowing where you are (but it can happen anywhere):

    https://www.9news.com/article/life/a...f-b8928893d4ba

    And notice the date on that ^ ^ ^ news story was December 30, 2020
    Last edited by Bogertophis; 05-21-2021 at 05:07 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  4. The Following 2 Users Say Thank You to Bogertophis For This Useful Post:

    Albert Clark (08-30-2022),BuddyK (05-21-2021)

  5. #3
    bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,501
    Thanks
    2,890
    Thanked 9,857 Times in 4,778 Posts
    Images: 34
    I'm sorry. Nido has hit a lot of collections hard and it seems like in the past year we're hearing more and more about it.

    The seller may not have even known it was sick since was eating and appeared outwardly healthy. Often the stress of shipping can cause it to flare up if the snake is carrying it.

    If you search for "nidovirus" on Youtube you can find videos with experiences that other breeders have had. Some lost a lot of animals.
    Last edited by bcr229; 05-22-2021 at 09:07 AM.

  6. The Following 3 Users Say Thank You to bcr229 For This Useful Post:

    Albert Clark (08-30-2022),Bogertophis (05-22-2021),Malum Argenteum (08-31-2022)

  7. #4
    BPnet Veteran Trinityblood's Avatar
    Join Date
    07-08-2020
    Posts
    297
    Thanks
    297
    Thanked 364 Times in 184 Posts
    Images: 6
    Sorry to hear that. Hope your snake pulls through. From what I've read, Nidovirus can lay dormant and have flareups like a cold sore. Only it's much worse. When they're not having flareups they can even test negative even though they are a carrier of the virus.

  8. The Following 2 Users Say Thank You to Trinityblood For This Useful Post:

    Albert Clark (08-30-2022),Bogertophis (05-22-2021)

  9. #5
    Registered User
    Join Date
    04-29-2020
    Posts
    27
    Thanks
    2
    Thanked 7 Times in 4 Posts
    Images: 26

    Re: My Ball Python tested positive for Nidovirus

    I have just gone through the same thing. Bought 2 ball pyhtons in December and in January they started showing signs of an RI so brought then to my reptile vet and nothing seemed to shift it so we sent off swabs and while waiting for them to come back my albino female passed away and once I got the result I has to bring in my pied female to be euthanized. Broke my heart. I had never heard about it before and its the most horrendous thing when you read about it.

  10. The Following User Says Thank You to SnKReptiles For This Useful Post:

    Bogertophis (05-23-2021)

  11. #6
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,243
    Thanks
    28,153
    Thanked 19,816 Times in 11,840 Posts

    Re: My Ball Python tested positive for Nidovirus

    Quote Originally Posted by SnKReptiles View Post
    I have just gone through the same thing. Bought 2 ball pyhtons in December and in January they started showing signs of an RI so brought then to my reptile vet and nothing seemed to shift it so we sent off swabs and while waiting for them to come back my albino female passed away and once I got the result I has to bring in my pied female to be euthanized. Broke my heart. I had never heard about it before and its the most horrendous thing when you read about it.
    That is so very sad, I'm so sorry about your losses. So sudden & unexpected- just awful.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  12. #7
    Registered User Amos1974's Avatar
    Join Date
    06-20-2010
    Location
    California, Bay Area
    Posts
    106
    Thanks
    17
    Thanked 62 Times in 35 Posts
    Images: 13
    Because buyers are afraid to name the breeders they got sick snakes from often times they don't get that reputation until some one says the name and then others realize "me too"... To have a "Big breeder" sending out snakes with Nidovirus is dangerous to the whole reptile community.

  13. The Following User Says Thank You to Amos1974 For This Useful Post:

    PeteV (05-23-2021)

  14. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Nidovirus is not an automatic death sentence. This narrative is solely down to the fact that the ability to test for the virus is stupidly easy but our actual knowledge of the virus and its behaviour/pathology/prevalence is pretty hazy.


    https://youtu.be/EU4iJMdD6Tw
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  15. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Albert Clark (08-30-2022),Bogertophis (05-24-2021),Malum Argenteum (09-01-2022)

  16. #9
    BPnet Veteran Hugsplox's Avatar
    Join Date
    08-27-2020
    Location
    Georgia, U.S.
    Posts
    695
    Thanks
    1,695
    Thanked 1,130 Times in 534 Posts

    Re: My Ball Python tested positive for Nidovirus

    Quote Originally Posted by Amos1974 View Post
    Because buyers are afraid to name the breeders they got sick snakes from often times they don't get that reputation until some one says the name and then others realize "me too"... To have a "Big breeder" sending out snakes with Nidovirus is dangerous to the whole reptile community.
    You know I read a story and an exchange between a buyer and big breeder a year or so ago. I'll leave the breeder's name off of this because this was an alleged situation and I don't know how true it is. Buyer picked up a handful of snakes from the breeder, over time found that they had nido, reached out to the breeder, didn't have a good experience, and took to forums/FB to comment on the situation.

    Two things happened as a result of this. One, the breeder got involved and began displaying some pretty poor customer service, and two and more importantly, the fans of this big breeder started attacking the buyer on his posts. Of course all the responses weren't an attack on the buyer, but there was a lot of blame shifting, excuses, alternate theories, etc etc.

    I do think if you have a bad experience with a breeder you should let the community know, but at the same time I understand why some people might be hesitant to do so based on situations like that one.

  17. The Following 3 Users Say Thank You to Hugsplox For This Useful Post:

    Albert Clark (08-30-2022),ballpythonluvr (05-24-2021),Bogertophis (05-24-2021)

  18. #10
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,243
    Thanks
    28,153
    Thanked 19,816 Times in 11,840 Posts

    Re: My Ball Python tested positive for Nidovirus

    Quote Originally Posted by asplundii View Post
    Nidovirus is not an automatic death sentence. This narrative is solely down to the fact that the ability to test for the virus is stupidly easy but our actual knowledge of the virus and its behaviour/pathology/prevalence is pretty hazy.


    https://youtu.be/EU4iJMdD6Tw
    Re video ^ ^ ^ Very interesting in depth discussion. Long video, you can skip at least the first 6 minutes of irrelevant chatter. Lots yet to be learned on this- thanks!
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  19. The Following 2 Users Say Thank You to Bogertophis For This Useful Post:

    Albert Clark (08-30-2022),asplundii (05-25-2021)

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1