Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,288

2 members and 3,286 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,533
Posts: 2,568,700
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Results 1 to 2 of 2
  1. #1
    Registered User Unknownism's Avatar
    Join Date
    04-02-2021
    Location
    California, USA
    Posts
    15
    Thanks
    11
    Thanked 10 Times in 4 Posts

    Hets vs other morphs appearance

    Hi y'all,

    Now we probably all know we can look at pictures all day on Google, but I'd rather see what some of the community's members experience had shown. I read a statement that heterozygous morphs can tend to strip out the appearance of the other morphs a snake may have. For instance an orange dream het tristripe that just looks like a normal. Now I do have two of my own snakes that are het & their pastel doesn't show, I know not all pastels are very vibrant, but could this be from the het recessive Gene's they have. I have another het that their lesser is blatantly clear in comparison. I'm just curious if anyone with decades of experience believes that this can occasionally be true, because I know it isn't an absolute truth, but I can see it being possible that some het recessive Gene's could block the het co-doms.

    Anyway I'd love to hear people's thoughts! Thanks y'all!

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The entire definition of a recessive gene revolves around the fact that there is no phenotypic expression when only one copy of the mutation is present. If the heterozygous state results in any change in phenotype then the gene is either dominant or incomplete-dominant in its expression
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    ballpythonluvr (04-08-2021),Bogertophis (04-08-2021),jmcrook (04-08-2021),Toad37 (04-08-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1