Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 332

9 members and 323 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

» Stats

Members: 70,731
Threads: 244,804
Posts: 2,538,102
Top Poster: JLC (31,651)
Welcome to our newest member, barrettj
Page 1 of 2 12 LastLast
Results 1 to 10 of 14
  1. #1
    Registered User HarryTB's Avatar
    Join Date
    04-15-2020
    Posts
    41
    Thanks
    40
    Thanked 195 Times in 39 Posts

    Grey Banded Kingsnake

    This is George, one of my favourites but donít tell the others




    Sent from my iPhone using Tapatalk

  2. The Following 13 Users Say Thank You to HarryTB For This Useful Post:

    + Show/Hide list of the thanked

    Alicia (03-12-2021),aurum (03-03-2021),bns (03-05-2021),Bogertophis (03-02-2021),dakski (03-02-2021),EL-Ziggy (03-06-2021),Hugsplox (03-02-2021),jmcrook (03-02-2021),nikkubus (03-02-2021),richardhind1972 (03-03-2021),Spicey (03-03-2021),Toad37 (03-02-2021),Trinityblood (03-02-2021)

  3. #2
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    14,176
    Thanks
    19,865
    Thanked 12,183 Times in 7,662 Posts
    Very cool...you don't see very many GBKs around these days. I'm sworn to silence, no worries...

    Nice match to your tat also.
    Last edited by Bogertophis; 03-02-2021 at 04:21 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  4. The Following User Says Thank You to Bogertophis For This Useful Post:

    HarryTB (03-02-2021)

  5. #3
    Registered User HarryTB's Avatar
    Join Date
    04-15-2020
    Posts
    41
    Thanks
    40
    Thanked 195 Times in 39 Posts

    Re: Grey Banded Kingsnake

    Quote Originally Posted by Bogertophis View Post
    Very cool...you don't see very many GBKs around these days. I'm sworn to silence, no worries...

    Nice match to your tat also.

    thanks, I hadnít seen one for years, Iím in the U.K., and 2 years ago I randomly called in a reptile store near to me and he was in there, only a few weeks old, and as theyíve been on my bucket list for years, I had to get him, but finding a female for him is near damn impossible. Yeah he definitely complements my tat 😉 what I love about him, Iíve had numerous types of kings and milks over the years and his temperament is the best Iíve ever had, heís a real star, never struck or bit and calm as anything being handled

  6. The Following 3 Users Say Thank You to HarryTB For This Useful Post:

    Bogertophis (03-02-2021),nikkubus (03-02-2021),richardhind1972 (03-03-2021)

  7. #4
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    14,176
    Thanks
    19,865
    Thanked 12,183 Times in 7,662 Posts

    Re: Grey Banded Kingsnake

    Quote Originally Posted by HarryTB View Post
    thanks, I hadn’t seen one for years, I’m in the U.K., and 2 years ago I randomly called in a reptile store near to me and he was in there, only a few weeks old, and as they’ve been on my bucket list for years, I had to get him, but finding a female for him is near damn impossible. Yeah he definitely complements my tat �� what I love about him, I’ve had numerous types of kings and milks over the years and his temperament is the best I’ve ever had, he’s a real star, never struck or bit and calm as anything being handled

    I've never kept those, but I've heard their temperaments tend to be mellower than most other king snakes. I have an "odd" snake in that general category too, a Texas longnose snake (red, black & yellow bands), also mellow & sadly, also "single". Like yours, mine was from a local pet store, but was a c/b yearling that they were unable to feed much less sell. I traded them one of my c/b king snakes that they could EASILY feed & sell, & saved this snake, who's now 19 years old. Longnose snakes, either Western or TX, are primarily lizard-eaters & not easily persuaded to take mice, but they were also native to the California desert where I lived then, & I already had some experience with them . A characteristic they may share with some of the gray-bandeds, I think? A little harder to get started eating, but so pretty & calm, obviously well-worth the efforts. "Many good things DO come in small packages".
    Last edited by Bogertophis; 03-02-2021 at 05:14 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  8. The Following 2 Users Say Thank You to Bogertophis For This Useful Post:

    HarryTB (03-03-2021),nikkubus (03-02-2021)

  9. #5
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    299
    Thanks
    831
    Thanked 355 Times in 199 Posts
    Very gorgeous. I haven't seen many around either. Are they tricky to get eating rodents?
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  10. The Following User Says Thank You to nikkubus For This Useful Post:

    HarryTB (03-03-2021)

  11. #6
    Registered User HarryTB's Avatar
    Join Date
    04-15-2020
    Posts
    41
    Thanks
    40
    Thanked 195 Times in 39 Posts

    Re: Grey Banded Kingsnake

    Quote Originally Posted by nikkubus View Post
    Very gorgeous. I haven't seen many around either. Are they tricky to get eating rodents?
    He was eating pinkies when I bought him and heís a fantastic feeder, he smashes mice every time, even when in blue

  12. The Following 2 Users Say Thank You to HarryTB For This Useful Post:

    Bogertophis (03-03-2021),nikkubus (03-03-2021)

  13. #7
    Registered User HarryTB's Avatar
    Join Date
    04-15-2020
    Posts
    41
    Thanks
    40
    Thanked 195 Times in 39 Posts

    Re: Grey Banded Kingsnake

    Quote Originally Posted by Bogertophis View Post
    I've never kept those, but I've heard their temperaments tend to be mellower than most other king snakes. I have an "odd" snake in that general category too, a Texas longnose snake (red, black & yellow bands), also mellow & sadly, also "single". Like yours, mine was from a local pet store, but was a c/b yearling that they were unable to feed much less sell. I traded them one of my c/b king snakes that they could EASILY feed & sell, & saved this snake, who's now 19 years old. Longnose snakes, either Western or TX, are primarily lizard-eaters & not easily persuaded to take mice, but they were also native to the California desert where I lived then, & I already had some experience with them . A characteristic they may share with some of the gray-bandeds, I think? A little harder to get started eating, but so pretty & calm, obviously well-worth the efforts. "Many good things DO come in small packages".
    Thatís a cool looking snake that Texas longnose, thatís a new one to me 😊 Iíve found a leucistic female for sale here, and I know theyíll throw ďnormalĒ babies, but the whole appeal of them to me is their colour/ pattern. The female also has a kink in its tail, which I have seen several times in leucistic specimens probably a genetic thing, and may possibly affect breeding 🤷🏻♂️ Never had a problem with this little one eating mice and rat pups, heís a little beast 😂😂

  14. The Following 2 Users Say Thank You to HarryTB For This Useful Post:

    Bogertophis (03-03-2021),nikkubus (03-03-2021)

  15. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    888
    Thanks
    95
    Thanked 680 Times in 365 Posts

    Re: Grey Banded Kingsnake

    Quote Originally Posted by Bogertophis View Post
    I've heard their temperaments tend to be mellower than most other king snakes.
    This is quite true. They are one of the most laid back species I have. Only ever taken a single bite and that was my fault for handling after eating crab and I guess the smell was enough to trigger a feed response.



    Quote Originally Posted by nikkubus View Post
    Very gorgeous. I haven't seen many around either.
    That is mostly down to the alterna community tending to be pretty insular. Once you get in to the groups though then they are not too difficult to get hold of


    Quote Originally Posted by nikkubus View Post
    Are they tricky to get eating rodents?
    They can be. My female took mice pinks from day one. My male I had to soak pinks in anole puree and then wrap them in gecko shed. That little ritual lasted six months before he started converting over. Once switched over they will eat just about anything. Mine love quail chicks and tilapia
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  16. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (03-03-2021),nikkubus (03-03-2021)

  17. #9
    BPnet Veteran richardhind1972's Avatar
    Join Date
    12-31-2017
    Location
    derbyshire, uk
    Posts
    4,279
    Thanks
    9,746
    Thanked 6,461 Times in 2,919 Posts

    Re: Grey Banded Kingsnake

    Amazing colour and markings

    Sent from my ELS-NX9 using Tapatalk

  18. The Following User Says Thank You to richardhind1972 For This Useful Post:

    HarryTB (03-03-2021)

  19. #10
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    14,176
    Thanks
    19,865
    Thanked 12,183 Times in 7,662 Posts

    Re: Grey Banded Kingsnake

    Quote Originally Posted by HarryTB View Post
    That’s a cool looking snake that Texas longnose, that’s a new one to me ��...
    Yes- mine is a beautiful tricolor. The pet store's source said it was eating mice pinks (& from the size it obviously was eating something to get to a still-tiny yearling size) but the pet store it was in had no luck feeding it at all- probably the lack of privacy & other issues of being on display.

    It refused pinks for me at home, but only at first. It had been a long time since it had eaten, so to give it some energy to make the appetite return, I gave a tube-feed of thinned Gerber's chicken baby food, & that worked very well. (I should note that I have a lot of experience at tube-feeding w/ a syringe & catheter.) Maybe a week after that (it was 18 years ago, lol), the snake acted hungry & when offered f/t pinkies, gulped them down enthusiastically & did from then on.

    Note: I thaw frozen prey IN water, & for this kind of snake that's important, as it washes OFF some of the mouse odor/taste. For that reason, f/t is much better accepted than live or fresh. Also, because this species has such a narrow gape (hence the name), I don't & never have fed one item per feeding. Always this snake gulps down a number of the appropriate size prey (pinks then, now fuzzies) that I estimate will fill the stomach. Snake is currently 30" or more, so a meal is 5 or 6 fuzzies, always at night & drop fed.

    This snake also refuses food in winter like clockwork for several months, even though not brumated (& loses some weight over winter, but not to a dangerous extent). Spring always is a fussy time when the snake is restless but still refuses food for a while. It's our springtime ritual, lol. (Perhaps looking for a non-existent mate, & btw, I've never sexed this snake, because I have zero intent of breeding them.)

    Might be a neat species to work with, since they're so pretty, & small, docile pets once well-started, but not a "beginner" snake IMO. The wild Western Longnose snakes I encountered had less or no red at all, btw. All are challenging to get on mice- they'd be eating lizards or other tiny snakes in the wild.
    Last edited by Bogertophis; 03-03-2021 at 12:37 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  20. The Following 3 Users Say Thank You to Bogertophis For This Useful Post:

    dakski (03-04-2021),HarryTB (03-03-2021),nikkubus (03-03-2021)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1