Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,437

7 members and 3,430 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,095
Threads: 248,538
Posts: 2,568,724
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Results 1 to 7 of 7
  1. #1
    Registered User
    Join Date
    09-17-2020
    Posts
    3
    Thanks
    4
    Thanked 1 Time in 1 Post

    I’m crazy, but could she be a secret pied?

    This is my little het pied girl, parents are a pastel yellowbelly het pied and a super black pastel pinstripe het pied.

    Two of her siblings are pied and she’s got this gorgeous, high yellow, almost peach/pink color on her sides, but along side her belly scales she has about 6 white normal scales. I know it’s highly unlikely, but there’s a part of me that hopes she’s the lowest white pied possible because it’s going to be years before I can prove out her het.

    She was sold as a black pastel yellow belly, pos pastel. What do y’all think on the pos pastel and my secret pied theory.









    Sent from my iPhone using Tapatalk

  2. #2
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,455
    Thanks
    622
    Thanked 3,197 Times in 1,091 Posts
    Images: 84

    Re: I’m crazy, but could she be a secret pied?

    Nice photos! Looks great!

    If she was homozygous pied I would expect the patterning to be significantly different.

    Not what I would expect for a Black Pastel Yellowbelly (even het pied) either.
    Last edited by Lord Sorril; 09-18-2020 at 02:29 AM.
    *.* TNTC

  3. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Alysun (09-18-2020)

  4. #3
    Registered User
    Join Date
    06-14-2020
    Posts
    39
    Thanks
    36
    Thanked 30 Times in 24 Posts
    She's a beauty!!

    IMO those are het pied ringers on her tail. Enjoy her regardless of genes!

    Really beautiful snake.

  5. The Following User Says Thank You to XpensiveWino For This Useful Post:

    Alysun (09-18-2020)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Your animal is a Pastel Yellowbelly het Pied. Those marks on her are what are known as "ringers" and they are not uncommon in het Pied animals (however, their presence is not proof of an animal being het Pied)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Alysun (09-18-2020)

  8. #5
    Registered User
    Join Date
    09-17-2020
    Posts
    3
    Thanks
    4
    Thanked 1 Time in 1 Post

    Re: I’m crazy, but could she be a secret pied?

    Quote Originally Posted by XpensiveWino View Post
    She's a beauty!!

    IMO those are het pied ringers on her tail. Enjoy her regardless of genes!

    Really beautiful snake.
    Thanks! I got her at a show last year and she was so pretty I couldn’t have taken anyone else home. I wanted to get a snake that was gorgeous and special in her own right especially since I may never breed her.

    I didn’t know that the ringers could be a presentation of the het, I thought it was just.a cool part of her pattern that made her extra pretty. Very interesting. The het pied was important to me though since I’d I do breed her I like the idea of pied babies. My brother has a leopard het pied make and I figured they could make some pretty cool snakes if I do decide to breed her when she grows up.


    Sent from my iPhone using Tapatalk

  9. The Following User Says Thank You to Alysun For This Useful Post:

    XpensiveWino (09-18-2020)

  10. #6
    Registered User
    Join Date
    06-14-2020
    Posts
    39
    Thanks
    36
    Thanked 30 Times in 24 Posts
    A leopard with your girl, whether they hit pied or not (they would for 50%??), would be beautiful. You've got a nice animal, and a cool project if you have access to another het pied.

  11. The Following User Says Thank You to XpensiveWino For This Useful Post:

    Alysun (09-26-2020)

  12. #7
    Registered User
    Join Date
    09-23-2020
    Posts
    17
    Thanks
    0
    Thanked 3 Times in 3 Posts

    Re: I’m crazy, but could she be a secret pied?

    Quote Originally Posted by asplundii View Post
    Your animal is a Pastel Yellowbelly het Pied. Those marks on her are what are known as "ringers" and they are not uncommon in het Pied animals (however, their presence is not proof of an animal being het Pied)
    I also think pastel yellow belly het pied

    Sent from my SM-G965U using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1