Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 442

9 members and 433 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

Jdrum6 (24)

» Stats

Members: 69,451
Threads: 243,855
Posts: 2,528,551
Top Poster: JLC (31,651)
Welcome to our newest member, Jsmith2121
Results 1 to 7 of 7
  1. #1
    Registered User
    Join Date
    09-17-2020
    Posts
    2
    Thanks
    4
    Thanked 1 Time in 1 Post

    Iím crazy, but could she be a secret pied?

    This is my little het pied girl, parents are a pastel yellowbelly het pied and a super black pastel pinstripe het pied.

    Two of her siblings are pied and sheís got this gorgeous, high yellow, almost peach/pink color on her sides, but along side her belly scales she has about 6 white normal scales. I know itís highly unlikely, but thereís a part of me that hopes sheís the lowest white pied possible because itís going to be years before I can prove out her het.

    She was sold as a black pastel yellow belly, pos pastel. What do yíall think on the pos pastel and my secret pied theory.









    Sent from my iPhone using Tapatalk

  2. #2
    BPnet Veteran Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    835
    Thanks
    429
    Thanked 977 Times in 506 Posts
    Images: 66

    Re: Iím crazy, but could she be a secret pied?

    Nice photos! Looks great!

    If she was homozygous pied I would expect the patterning to be significantly different.

    Not what I would expect for a Black Pastel Yellowbelly (even het pied) either.
    Last edited by Lord Sorril; 09-18-2020 at 02:29 AM.
    *.* TNTC

  3. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Alysun (09-18-2020)

  4. #3
    Registered User
    Join Date
    06-14-2020
    Posts
    32
    Thanks
    31
    Thanked 26 Times in 20 Posts
    She's a beauty!!

    IMO those are het pied ringers on her tail. Enjoy her regardless of genes!

    Really beautiful snake.

  5. The Following User Says Thank You to XpensiveWino For This Useful Post:

    Alysun (09-18-2020)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    877
    Thanks
    92
    Thanked 657 Times in 355 Posts
    Your animal is a Pastel Yellowbelly het Pied. Those marks on her are what are known as "ringers" and they are not uncommon in het Pied animals (however, their presence is not proof of an animal being het Pied)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Alysun (09-18-2020)

  8. #5
    Registered User
    Join Date
    09-17-2020
    Posts
    2
    Thanks
    4
    Thanked 1 Time in 1 Post

    Re: Iím crazy, but could she be a secret pied?

    Quote Originally Posted by XpensiveWino View Post
    She's a beauty!!

    IMO those are het pied ringers on her tail. Enjoy her regardless of genes!

    Really beautiful snake.
    Thanks! I got her at a show last year and she was so pretty I couldnít have taken anyone else home. I wanted to get a snake that was gorgeous and special in her own right especially since I may never breed her.

    I didnít know that the ringers could be a presentation of the het, I thought it was just.a cool part of her pattern that made her extra pretty. Very interesting. The het pied was important to me though since Iíd I do breed her I like the idea of pied babies. My brother has a leopard het pied make and I figured they could make some pretty cool snakes if I do decide to breed her when she grows up.


    Sent from my iPhone using Tapatalk

  9. The Following User Says Thank You to Alysun For This Useful Post:

    XpensiveWino (09-18-2020)

  10. #6
    Registered User
    Join Date
    06-14-2020
    Posts
    32
    Thanks
    31
    Thanked 26 Times in 20 Posts
    A leopard with your girl, whether they hit pied or not (they would for 50%??), would be beautiful. You've got a nice animal, and a cool project if you have access to another het pied.

  11. The Following User Says Thank You to XpensiveWino For This Useful Post:

    Alysun (09-26-2020)

  12. #7
    Registered User
    Join Date
    09-23-2020
    Posts
    17
    Thanks
    0
    Thanked 3 Times in 3 Posts

    Re: Iím crazy, but could she be a secret pied?

    Quote Originally Posted by asplundii View Post
    Your animal is a Pastel Yellowbelly het Pied. Those marks on her are what are known as "ringers" and they are not uncommon in het Pied animals (however, their presence is not proof of an animal being het Pied)
    I also think pastel yellow belly het pied

    Sent from my SM-G965U using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1