» Site Navigation
3 members and 3,499 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,722
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Registered User
-
-
Re: First Clutch White Snake Red Pupils??
Got any photos of the parents?
Sent from my LGL164VL using Tapatalk
-
-
Registered User
Re: First Clutch White Snake Red Pupils??
Here are the parents. Pastel Banana and Banana Butter.
-
-
Re: First Clutch White Snake Red Pupils??
Originally Posted by chemdogxxx
Here are the parents. Pastel Banana and Banana Butter.
Hmm that's really odd, the parents look like they are a pastel banana and a banana butter, do you know the pairings that made either of those 2? The only way you should have bel is if the pastel banana has a bel complex gene but its hard to tell unless you know what pairing produced it
Sent from my LGL164VL using Tapatalk
Last edited by Alexiel03; 08-22-2020 at 09:42 PM.
-
-
Either way what a score!!!
I’m just a bill sitting on top of capital hill.
-
The Following User Says Thank You to Danger noodles For This Useful Post:
-
Re: First Clutch White Snake Red Pupils??
Is it mom or dad that has butter in it? Also, is the animal a female? You said that the other six didn't make it.. Did they develop in the egg and were just dead or did the eggs go bad?
-
-
Given the high mortality rate of the clutch and the phenotype of the survivor, I would lay odds that this was a parthenogenesis event. Your animal is a SuperButter (possible SuperBanana). It will be female. And given the results that Warren Booth has seen, should be a pet only and not bred
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|