Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 420

9 members and 411 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

» Stats

Members: 68,843
Threads: 243,330
Posts: 2,524,087
Top Poster: JLC (31,651)
Welcome to our newest member, F2007KR
Results 1 to 3 of 3
  1. #1
    Registered User
    Join Date
    07-27-2020
    Posts
    6
    Thanks
    2
    Thanked 0 Times in 0 Posts

    BUG - EYE ??? : Albino Texas Leucistic rat snake








    Any possibility of bug eye??

    Can anyone explain its genetics?

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    869
    Thanks
    91
    Thanked 652 Times in 351 Posts
    I cannot see your pics

    Leucistics of any species have a tendency toward bug-eyes, it is an inherent side effect of the mutation
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (07-29-2020)

  4. #3
    BPnet Lifer Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,032
    Thanks
    2,233
    Thanked 3,917 Times in 2,468 Posts

    Re: BUG - EYE ??? : Albino Texas Leucistic rat snake

    I had a pay for these years ago and one of them had bug eyes .. I bought one and the breeder gave me the bug eye for free


    I think itís just part of their genetics ?

    Seems fairly common with them anyways


    Sent from my iPhone using Tapatalk Pro




Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1