Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 460

7 members and 453 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

» Stats

Members: 68,868
Threads: 243,341
Posts: 2,524,161
Top Poster: JLC (31,651)
Welcome to our newest member, rpinnell
Results 1 to 5 of 5

Thread: Bredlis pythons

  1. #1
    Registered User WILDBILL245's Avatar
    Join Date
    01-14-2019
    Location
    GEORGIA
    Posts
    52
    Thanks
    1
    Thanked 9 Times in 6 Posts
    Images: 2

    Bredlis pythons

    I Am Interested In Getting A Bredlis Carpet Python. I Have Seen Pics Of Some Nice Bright Red Patterns In Some. I Don't Want A Hypo Because Of The Cost But A Normal Phase One. Are There Any Or Are All The Dark Red? Where Are The Places I Can Purchase One From?

  2. #2
    Registered User Toad37's Avatar
    Join Date
    11-02-2018
    Location
    Midwest
    Posts
    467
    Thanks
    911
    Thanked 600 Times in 257 Posts

    Re: Bredlis pythons

    "Normal phases" are dark red. That's their natural wild pattern and color to be able to blend in with the red soil and rocks in Alice springs Australia. Nick Mutton at Inland Reptiles is the Morelia God if you're looking for great animals from a purist breeder but there are also a ton of other breeders out there.

  3. The Following 2 Users Say Thank You to Toad37 For This Useful Post:

    Craiga 01453 (07-04-2020),Gio (07-06-2020)

  4. #3
    BPnet Veteran Craiga 01453's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,248
    Thanks
    13,778
    Thanked 10,352 Times in 5,070 Posts
    My girl came from Casey Cannon of Cannon Fire Reptiles. I honestly couldn't be happier. She's awesome. Casey was really easy to talk to, helpful and Fernie was shipped perfectly.

    I'm giving serious consideration to adding a male Bredli and I'd go back to Casey in a heartbeat. But you obviously can't go wrong with an animal from Nick either.
    ...life is beautiful...

    1.0 Jungle Carpet Python - Cornell
    0.1 Bredli Python - Fernie
    1.0 Vanilla het Pied BP - Tyson
    1.0 Pastel Fader BP - Dembe
    1.0 Western Hognose - Cosmo
    1.0 Borneo Short Tail Python - Juice
    1.0 Anery Kenyan Sando Boa - Willow
    2.2 Ferrets - Baloo, Johnny & June and Chloe
    0.2 Cats - Simba & Nala

    1.0 California Kingsnake - Django (R.I.P. sweet boy)

  5. The Following User Says Thank You to Craiga 01453 For This Useful Post:

    Gio (07-06-2020)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    869
    Thanks
    91
    Thanked 652 Times in 351 Posts
    The "Affors" line tend to have less black to them and be a bit brighter red, the "poor man's Hypo" if you will. There are a few other breeders out there that have selectively bred for redder animals but you will be paying a bit more for the time they have put into the project that you would for a regular animal.

    Casey and Nick are both great sources for bredli, I have an animal from each of them.

    Owen McIntyre of Rogue Reptiles/Morelia Python Radio podcast is also a great source. I do not have any animals from him but I have seen his breeders and they are top quality
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    jmcrook (07-06-2020)

  8. #5
    BPnet Veteran Craiga 01453's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,248
    Thanks
    13,778
    Thanked 10,352 Times in 5,070 Posts

    Re: Bredlis pythons

    Quote Originally Posted by asplundii View Post
    The "Affors" line tend to have less black to them and be a bit brighter red, the "poor man's Hypo" if you will. There are a few other breeders out there that have selectively bred for redder animals but you will be paying a bit more for the time they have put into the project that you would for a regular animal.

    Casey and Nick are both great sources for bredli, I have an animal from each of them.

    Owen McIntyre of Rogue Reptiles/Morelia Python Radio podcast is also a great source. I do not have any animals from him but I have seen his breeders and they are top quality
    Good point about the Affors line. My girl is Affors line and I believe Casey was working primarily with Affors this season.
    ...life is beautiful...

    1.0 Jungle Carpet Python - Cornell
    0.1 Bredli Python - Fernie
    1.0 Vanilla het Pied BP - Tyson
    1.0 Pastel Fader BP - Dembe
    1.0 Western Hognose - Cosmo
    1.0 Borneo Short Tail Python - Juice
    1.0 Anery Kenyan Sando Boa - Willow
    2.2 Ferrets - Baloo, Johnny & June and Chloe
    0.2 Cats - Simba & Nala

    1.0 California Kingsnake - Django (R.I.P. sweet boy)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1