Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 256

12 members and 244 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

Landherr22 (28)

» Stats

Members: 68,672
Threads: 243,159
Posts: 2,522,739
Top Poster: JLC (31,651)
Welcome to our newest member, benrayburn
Results 1 to 3 of 3
  1. #1
    BPnet Lifer PghBall's Avatar
    Join Date
    04-20-2009
    Location
    Pleasant Hills, Pennsylvania
    Posts
    2,681
    Thanks
    987
    Thanked 1,189 Times in 951 Posts
    Images: 5

    Super Redhead (Envy)

    I produced three Super Redheads last season. We've decided to name the super the Envy. This is the female Envy het Hypo.

    Sent from my moto g(6) play using Tapatalk
    - Greg

    Visit our Facebook page: https://www.facebook.com/412Balls/



    or our website: http://412balls.weebly.com/

  2. The Following User Says Thank You to PghBall For This Useful Post:

    richardhind1972 (06-30-2020)

  3. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    863
    Thanks
    91
    Thanked 648 Times in 348 Posts
    I heard a rumour that RedHead is allelic to BlkPastel complex, any truth to that??
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    PghBall (06-30-2020)

  5. #3
    BPnet Lifer PghBall's Avatar
    Join Date
    04-20-2009
    Location
    Pleasant Hills, Pennsylvania
    Posts
    2,681
    Thanks
    987
    Thanked 1,189 Times in 951 Posts
    Images: 5

    Re: Super Redhead (Envy)

    Not that I'm aware of. Another friend of mine produced a Redhead Black Pastel combo and although a nice looking combo, not allelic. There are a lot of combos we've not tried yet with Redhead so time will tell.
    - Greg

    Visit our Facebook page: https://www.facebook.com/412Balls/



    or our website: http://412balls.weebly.com/

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1