» Site Navigation
4 members and 2,864 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,079
Threads: 248,524
Posts: 2,568,630
Top Poster: JLC (31,651)
|
-
Registered User
Dawn Dish Soap and Snakes?
My snake, Mango, was around my neck and she got herself stuck in one of my hoop earrings. I took out the earring and tried to take it off her, but it was stuck, so I used Dawn soap to make it slippery and it came right off. I would never bathe her in dish soap, so I'm not asking this because that's my intent, but I just wanted to make sure that she'll be okay? She didn't seem bothered by it, and I rinsed her off afterward.
-
-
KMG
0.1 BP 1.1 Blood Python 1.0 Brazilian Rainbow Boa 1.0 Aru Green Tree Python
0.1 Emerald Tree Boa 0.1 Dumeril Boa 0.1 Carpet Python 0.1 Central American Boa
0.1 Brooks Kingsnake 0.1 Speckled Kingsnake 1.0 Western Hognose
0.1 Blonde Madagascar Hognose 1.0 Columbian Boa
1.1 Olde English Bulldogge 1.0 Pit Bull
-
The Following User Says Thank You to KMG For This Useful Post:
Dragonslayer (06-10-2020)
-
As KMG said, your snake will be fine.
I do not make it a regular thing to wash my snakes but after I remove eggs from a female I always wash her with a little dish soap to clean the egg scent off her. Gets them to switch away from maternal behaviour and back to normal behaviour a bit faster
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (06-09-2020),Dragonslayer (06-10-2020)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|