Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,821

0 members and 2,821 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,087
Threads: 248,528
Posts: 2,568,676
Top Poster: JLC (31,651)
Welcome to our newest member, FayeZero
Results 1 to 3 of 3
  1. #1
    Registered User Dragonslayer's Avatar
    Join Date
    12-04-2019
    Posts
    12
    Thanks
    2
    Thanked 1 Time in 1 Post

    Dawn Dish Soap and Snakes?

    My snake, Mango, was around my neck and she got herself stuck in one of my hoop earrings. I took out the earring and tried to take it off her, but it was stuck, so I used Dawn soap to make it slippery and it came right off. I would never bathe her in dish soap, so I'm not asking this because that's my intent, but I just wanted to make sure that she'll be okay? She didn't seem bothered by it, and I rinsed her off afterward.

  2. #2
    BPnet Royalty KMG's Avatar
    Join Date
    06-09-2012
    Location
    Tx
    Posts
    5,633
    Thanks
    1,032
    Thanked 2,944 Times in 1,958 Posts
    Images: 55
    It will be fine.
    KMG
    0.1 BP 1.1 Blood Python 1.0 Brazilian Rainbow Boa 1.0 Aru Green Tree Python
    0.1 Emerald Tree Boa 0.1 Dumeril Boa 0.1 Carpet Python 0.1 Central American Boa
    0.1 Brooks Kingsnake 0.1 Speckled Kingsnake 1.0 Western Hognose
    0.1 Blonde Madagascar Hognose 1.0 Columbian Boa

    1.1 Olde English Bulldogge 1.0 Pit Bull

  3. The Following User Says Thank You to KMG For This Useful Post:

    Dragonslayer (06-10-2020)

  4. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    As KMG said, your snake will be fine.

    I do not make it a regular thing to wash my snakes but after I remove eggs from a female I always wash her with a little dish soap to clean the egg scent off her. Gets them to switch away from maternal behaviour and back to normal behaviour a bit faster
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (06-09-2020),Dragonslayer (06-10-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1