» Site Navigation
1 members and 2,622 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,014
Threads: 248,474
Posts: 2,568,391
Top Poster: JLC (31,651)
|
-
Registered User
Re: Parthenogenesis occurred
Originally Posted by asplundii
That is a fairly decent break-down. Only caveat I would put on it is that the sex part is incorrect with respect to ball pythons (really, all pythons and boas if you want to be technical) as balls are X/Y and not the Z/W that Komodos are
I thought everything was X and Y, at least within vertebrates, but its much more complex than that...
In snakes[edit]
Snake W chromosomes show different levels of decay compared to their Z chromosomes. This allows for tracking the shrinking of W chromosomes by comparing across species. Mapping of specific genes reveals that the snake system is different from the bird system. It is not yet known which gene is the sex-determining one in snakes. One thing that stood out was that Python show little signs of "W-shrinking".[6]
Boa and Python families are now known to probably have an XY sex-determination system.[17] Interest in looking into this came from female family members capable of parthenogenesis, or producing offspring without mating. In 2010 a female Boa constrictor that produced 22 female offspring in this manner was found in the wild. By then it was presumed that such a pattern was produced by WW chromosomes.[18] Python bivittatus and Boa imperator, similarly only produce female offspring; their genomes share male-specific single nucleotide polymorphisms identifiable by restrictive enzyme digestion. Their chromosomal origins, however, differ: Python's XY are similar to other snakes' ZW, while Boa XY maps to microchromosomes in other snakes.[19] The female-only pattern is in contrast to the ZW Colubroidean parthenogens, which always produce male (ZZ) offspring.[20]
-
-
Re: Parthenogenesis occurred
Originally Posted by colin-java
I thought everything was X and Y, at least within vertebrates, but its much more complex than that...
Nope. All mammals are X/Y, all birds are Z/W, amphibians lizards, snakes and insects have both (which is to say that some do X/Y and some do Z/W and not they have all four at once)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Parthenogenesis occurred
Originally Posted by Bogertophis
All the best with your gal...I don't expect her to go off-food for quite a while this year- if at all, but only time will tell. We'll be curious, right along with you, to see what's next.
She just shed today, and I gave her a 220g F/T rat warmed up and she constricted it in about a second.
So 2 out of 2 now.
She wouldn't settle in her hide box the week following the eggs, but then slowly started to settle a bit more.
Then after the first rat she hasn't come out of the box at all, so it looks like things are getting back to normal now.
-
The Following 2 Users Say Thank You to colin-java For This Useful Post:
Bogertophis (06-24-2020),EL-Ziggy (06-24-2020)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|