Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 432

2 members and 430 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

» Stats

Members: 67,561
Threads: 242,149
Posts: 2,513,343
Top Poster: JLC (31,651)
Welcome to our newest member, Liamsayslol
Results 1 to 10 of 10
  1. #1
    Registered User Moose84's Avatar
    Join Date
    04-20-2019
    Posts
    250
    Thanks
    103
    Thanked 237 Times in 118 Posts

    Acid Ball Pythons

    Finally stepped into this project. Josh from J-Royals was excellent. Highly recommended. Canít wait to work with this gene for the next decade or so.

    Female is Acid X YB

    Male is Acid X OD





    Sent from my iPhone using Tapatalk

  2. The Following 6 Users Say Thank You to Moose84 For This Useful Post:

    Bodie (03-25-2020),cincy (03-26-2020),dakski (03-25-2020),Damien79 (03-25-2020),rufretic (03-25-2020),Sonny1318 (03-25-2020)

  3. #2
    Registered User
    Join Date
    02-05-2020
    Location
    Hickory, North Carolina
    Posts
    63
    Thanks
    67
    Thanked 28 Times in 20 Posts

    Re: Acid Ball Pythons

    Amazing snakes!!

  4. The Following User Says Thank You to Damien79 For This Useful Post:

    Moose84 (03-25-2020)

  5. #3
    BPnet Veteran rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,185
    Thanks
    919
    Thanked 1,141 Times in 668 Posts
    Images: 11
    Very nice picks! I feel you on the excitement about working with acid, I just picked one up myself not long ago. I actually considered both of those but ended up going with a male acid reflux that I just really loved the crazy pattern on. Looking at your acid yb, I'm scratching my head if I made the right choice lol, that color looks so nice! Both are really nice, congrats and good luck with the project!

  6. The Following User Says Thank You to rufretic For This Useful Post:

    Sonny1318 (03-26-2020)

  7. #4
    Registered User Moose84's Avatar
    Join Date
    04-20-2019
    Posts
    250
    Thanks
    103
    Thanked 237 Times in 118 Posts

    Re: Acid Ball Pythons

    I know exactly which one you got. Itís unreal. Just canít wait to see what it can do with an array of co-dom genes. Iím not even in a rush to get into clown really. It really breathes life into the pinstripes. I know people have gone away from the pins but with this gene it opens up a myriad of options.


    Sent from my iPhone using Tapatalk

  8. The Following 2 Users Say Thank You to Moose84 For This Useful Post:

    rufretic (03-25-2020),Sonny1318 (03-25-2020)

  9. #5
    Registered User Bodie's Avatar
    Join Date
    11-19-2018
    Location
    Goofy Florida
    Posts
    483
    Thanks
    1,254
    Thanked 400 Times in 271 Posts

    Re: Acid Ball Pythons

    Good lookin BPs Moose. Congrats
    0.1 Emerald Tree Boa (Northern) "Ozzie"
    0.1 Green Tree Python (Aru) "Sassy"
    0.1 Pueblan Milk Snake "Milkshake"
    1.0 Mexican Black Kingsnake "Sooty"
    1.0 Pied Het Lavender Albino Ball Python "Socket"
    1.0 Yellow Phase Eastern Hognose "Piggy Smalls"

  10. The Following User Says Thank You to Bodie For This Useful Post:

    Moose84 (03-25-2020)

  11. #6
    BPnet Senior Member Sonny1318's Avatar
    Join Date
    07-02-2014
    Location
    Chicago
    Posts
    2,173
    Thanks
    4,312
    Thanked 1,447 Times in 1,077 Posts
    Images: 9
    Simply beautiful man, congratulations! And best of luck!
    1.0 Black Pastel Pinstripe
    1.0 Reduced Pattern Clown
    1.0 Low White Pied
    1.0 Hypo Super Enchi

  12. The Following User Says Thank You to Sonny1318 For This Useful Post:

    Moose84 (03-26-2020)

  13. #7
    BPnet Veteran rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,185
    Thanks
    919
    Thanked 1,141 Times in 668 Posts
    Images: 11

    Re: Acid Ball Pythons

    Quote Originally Posted by Moose84 View Post
    I know exactly which one you got. Itís unreal. Just canít wait to see what it can do with an array of co-dom genes. Iím not even in a rush to get into clown really. It really breathes life into the pinstripes. I know people have gone away from the pins but with this gene it opens up a myriad of options.


    Sent from my iPhone using Tapatalk

    Yep, I completely agree. I love clown stuff but too many are working with it, I'm really wanting to go for new combos and creating some cool stuff that nobody else has. I'll be mixing mine right into DG his first season. I have loved what I've seen acid do to pinstripe stuff so one of my girls he'll almost for sure be going to is my pin lesser leopard DG. Should be the start to some crazy new things. I also really like it with spotnose, leopard and I'm not sure if it's been done yet but blackhead should be interesting. And then of course I got him with yb because I have some interesting asphalt combos that should make some wild stuff I have been brainstorming a lot lately lol.

  14. The Following 2 Users Say Thank You to rufretic For This Useful Post:

    Moose84 (03-26-2020),Sonny1318 (03-26-2020)

  15. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    841
    Thanks
    89
    Thanked 629 Times in 336 Posts

    Re: Acid Ball Pythons

    Quote Originally Posted by rufretic View Post
    I'm not sure if it's been done yet but blackhead should be interesting.
    Acid Blackhead has been done, it was interesting but not overwhelming. The Acid Blackhead BlkPastel though... That will blow your damn mind:

    https://community.morphmarket.com/up...f8e7a2ec8.jpeg
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  16. The Following User Says Thank You to asplundii For This Useful Post:

    rufretic (03-26-2020)

  17. #9
    Registered User Moose84's Avatar
    Join Date
    04-20-2019
    Posts
    250
    Thanks
    103
    Thanked 237 Times in 118 Posts

    Re: Acid Ball Pythons

    Sick..... unreal.


    Sent from my iPhone using Tapatalk

  18. The Following 2 Users Say Thank You to Moose84 For This Useful Post:

    asplundii (03-27-2020),Sonny1318 (03-26-2020)

  19. #10
    BPnet Veteran rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,185
    Thanks
    919
    Thanked 1,141 Times in 668 Posts
    Images: 11

    Re: Acid Ball Pythons

    Quote Originally Posted by asplundii View Post
    Acid Blackhead has been done, it was interesting but not overwhelming. The Acid Blackhead BlkPastel though... That will blow your damn mind:

    https://community.morphmarket.com/up...f8e7a2ec8.jpeg
    Oh man, if I could hit that with DG and it keeps the bold solid black but brightens up what little pattern is left giving it a little contrast, should be jaw dropping! It will take some time but could be well worth it and I already have the ingredients so why not haha.

  20. The Following 3 Users Say Thank You to rufretic For This Useful Post:

    asplundii (03-27-2020),Moose84 (03-26-2020),Sonny1318 (03-26-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1