» Site Navigation
4 members and 2,704 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,083
Threads: 248,525
Posts: 2,568,638
Top Poster: JLC (31,651)
|
-
-
The Following 6 Users Say Thank You to Moose84 For This Useful Post:
Bodie (03-25-2020),cincy (03-26-2020),dakski (03-25-2020),Damien79 (03-25-2020),rufretic (03-25-2020),Sonny1318 (03-25-2020)
-
Registered User
-
The Following User Says Thank You to Damien79 For This Useful Post:
-
Very nice picks! I feel you on the excitement about working with acid, I just picked one up myself not long ago. I actually considered both of those but ended up going with a male acid reflux that I just really loved the crazy pattern on. Looking at your acid yb, I'm scratching my head if I made the right choice lol, that color looks so nice! Both are really nice, congrats and good luck with the project!
-
The Following User Says Thank You to rufretic For This Useful Post:
-
Re: Acid Ball Pythons
I know exactly which one you got. It’s unreal. Just can’t wait to see what it can do with an array of co-dom genes. I’m not even in a rush to get into clown really. It really breathes life into the pinstripes. I know people have gone away from the pins but with this gene it opens up a myriad of options.
Sent from my iPhone using Tapatalk
-
The Following 2 Users Say Thank You to Moose84 For This Useful Post:
rufretic (03-25-2020),Sonny1318 (03-25-2020)
-
Re: Acid Ball Pythons
Good lookin BPs Moose. Congrats
0.1 Emerald Tree Boa (Northern)
0.1 Green Tree Python (Aru)
0.1 Pueblan Milk Snake
1.0 Mexican Black Kingsnake
1.0 Pied Het Lavender Albino Ball Python
1.0 Yellow Phase Eastern Hognose
-
The Following User Says Thank You to Bodie For This Useful Post:
-
Simply beautiful man, congratulations! And best of luck!
1.0 Black Pastel Pinstripe
1.0 Reduced Pattern Clown
1.0 Low White Pied
1.0 Hypo Super Enchi
-
The Following User Says Thank You to Sonny1318 For This Useful Post:
-
Re: Acid Ball Pythons
Originally Posted by Moose84
I know exactly which one you got. It’s unreal. Just can’t wait to see what it can do with an array of co-dom genes. I’m not even in a rush to get into clown really. It really breathes life into the pinstripes. I know people have gone away from the pins but with this gene it opens up a myriad of options.
Sent from my iPhone using Tapatalk
Yep, I completely agree. I love clown stuff but too many are working with it, I'm really wanting to go for new combos and creating some cool stuff that nobody else has. I'll be mixing mine right into DG his first season. I have loved what I've seen acid do to pinstripe stuff so one of my girls he'll almost for sure be going to is my pin lesser leopard DG. Should be the start to some crazy new things. I also really like it with spotnose, leopard and I'm not sure if it's been done yet but blackhead should be interesting. And then of course I got him with yb because I have some interesting asphalt combos that should make some wild stuff I have been brainstorming a lot lately lol.
-
The Following 2 Users Say Thank You to rufretic For This Useful Post:
Moose84 (03-26-2020),Sonny1318 (03-26-2020)
-
Re: Acid Ball Pythons
Originally Posted by rufretic
I'm not sure if it's been done yet but blackhead should be interesting.
Acid Blackhead has been done, it was interesting but not overwhelming. The Acid Blackhead BlkPastel though... That will blow your damn mind:
https://community.morphmarket.com/up...f8e7a2ec8.jpeg
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Acid Ball Pythons
Sick..... unreal.
Sent from my iPhone using Tapatalk
-
The Following 2 Users Say Thank You to Moose84 For This Useful Post:
asplundii (03-27-2020),Sonny1318 (03-26-2020)
-
Re: Acid Ball Pythons
Originally Posted by asplundii
Oh man, if I could hit that with DG and it keeps the bold solid black but brightens up what little pattern is left giving it a little contrast, should be jaw dropping! It will take some time but could be well worth it and I already have the ingredients so why not haha.
-
The Following 3 Users Say Thank You to rufretic For This Useful Post:
asplundii (03-27-2020),Moose84 (03-26-2020),Sonny1318 (03-26-2020)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|