Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 367

10 members and 357 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.


» Today's Birthdays

None

» Stats

Members: 67,152
Threads: 241,789
Posts: 2,510,019
Top Poster: JLC (31,651)
Welcome to our newest member, robertbarryjr
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 27
  1. #11
    Registered User Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    10,734
    Thanks
    14,807
    Thanked 8,640 Times in 5,522 Posts
    I would assume that the Rhino rat snake starts his shed by loosening the skin around his mouth, as others do, but it must be a challenge to then get that prominent
    snoot completely peeled? That Malagasy leaf-nosed snake is another unique-looking snake. I keep a Texas longnose snake but his nose is nowhere
    near as long or pointed as all the ones above. (but he's a pretty tri-color, red, black & light yellow) I think those spider-tailed vipers are crazy
    looking- otherwise it looks a lot like the sidewinders I used to keep, very similar coloration, just rougher scales & what a tail!
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    833
    Thanks
    85
    Thanked 608 Times in 330 Posts

    Re: Which snake is the weirdest?

    Quote Originally Posted by Blitzjg View Post
    Is it true that dragon snakes aren't able to be kept in captivity successfully?
    Quote Originally Posted by Bogertophis View Post
    Sadly yes, that's what I've read too, but eventually someone may figure out how to?
    People have been figuring it out but they are certainly not easy:

    https://www.outbackreptiles.com/2018...ke-care-sheet/
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (02-13-2020)

  4. #13
    BPnet Veteran Blitzjg's Avatar
    Join Date
    07-01-2013
    Location
    Detroit, MI
    Posts
    234
    Thanks
    20
    Thanked 12 Times in 9 Posts

    Re: Which snake is the weirdest?

    Is there any documentation on the function/use of these extended noses? I could assume its for burrowing or sensing, but would like to know if it's been investigated.

    1.0 Link, my Abbott Okeetee corn snake
    1.0 Pit, my Yellow-belly ball python
    1.1 Ramza and Midna, my kittens

  5. #14
    BPnet Lifer Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    5,764
    Thanks
    2,174
    Thanked 3,658 Times in 2,304 Posts

    Re: Which snake is the weirdest?

    Quote Originally Posted by Blitzjg View Post
    Is there any documentation on the function/use of these extended noses? I could assume its for burrowing or sensing, but would like to know if it's been investigated.
    Iím honestly not sure although itís very soft and bendy so nothing to do with burrowing..


    Sent from my iPhone using Tapatalk Pro




  6. The Following 2 Users Say Thank You to Zincubus For This Useful Post:

    Bogertophis (02-13-2020),Luvyna (02-13-2020)

  7. #15
    Registered User Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    10,734
    Thanks
    14,807
    Thanked 8,640 Times in 5,522 Posts

    Re: Which snake is the weirdest?

    Quote Originally Posted by Zincubus View Post
    Iím honestly not sure although itís very soft and bendy so nothing to do with burrowing..


    Sent from my iPhone using Tapatalk Pro
    I'm picturing "sword-fights" between rivals...
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  8. #16
    Registered User Luvyna's Avatar
    Join Date
    01-06-2019
    Posts
    495
    Thanks
    660
    Thanked 415 Times in 265 Posts

    Re: Which snake is the weirdest?

    Quote Originally Posted by Zincubus View Post
    Iím honestly not sure although itís very soft and bendy so nothing to do with burrowing..


    Sent from my iPhone using Tapatalk Pro
    Very interesting, I imagined them stiffer than that. I couldn't easily find any info on the reason for it online.

  9. #17
    Registered User Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    10,734
    Thanks
    14,807
    Thanked 8,640 Times in 5,522 Posts

    Re: Which snake is the weirdest?

    Quote Originally Posted by Luvyna View Post
    Very interesting, I imagined them stiffer than that. I couldn't easily find any info on the reason for it online.
    It's like a "runaway" egg tooth? I wonder if they have unusually-tough eggs to get out of?

    Or maybe they're evolving a rattle on the wrong end (their nose!)? Reminds me of that Far Side cartoon of a rattlesnake family...'mom' & 'dad' are on either side of 'junior' who persists in rattling his head instead of his tail, & the mom says to the dad "this is YOUR side of the family, you realize..."
    Last edited by Bogertophis; 02-13-2020 at 10:50 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  10. #18
    BPnet Lifer Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    5,764
    Thanks
    2,174
    Thanked 3,658 Times in 2,304 Posts

    Re: Which snake is the weirdest?

    I looked online and it doesnít seem to have a use ..


    Sent from my iPhone using Tapatalk Pro




  11. #19
    BPnet Senior Member GoingPostal's Avatar
    Join Date
    08-09-2009
    Location
    MN
    Posts
    1,011
    Thanks
    2,184
    Thanked 800 Times in 436 Posts
    On the weird looking side, both elephant trunk or tentacled snakes. I like aquatic snakes but too scared to try them yet.
    Last edited by GoingPostal; 02-14-2020 at 12:14 PM.
    2.0 Python brongersmai
    1.1 Python breitensteini
    1.0 Python curtus
    1.0 Python regius
    1.0 Acrantophis dumerili
    1.0 Boa constrictor
    1.0 green iguana
    0.1 Heterodon nasiscus nasiscus

  12. #20
    BPnet Lifer Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    5,764
    Thanks
    2,174
    Thanked 3,658 Times in 2,304 Posts

    Which snake is the weirdest?

    My vote goes to the triangular prismed Cape File snakes .

    They look incredible and feel even better when handled !!

    Mine was very shy and retiring yet in the wild they prey regularly on other snakes, including cobras and puff adders !

    The Cape file snake (M. capensis) of central Africa is one of the largest species. They apparently grow very large , very quickly in the wild as their main diet is listed as venomous snakes ! Theyíre totally harmless to humans yet will eat any other snakes they find plus lizards , toads and frogs !!




    Sent from my iPhone using Tapatalk Pro
    Last edited by Zincubus; 02-14-2020 at 03:02 PM.




  13. The Following User Says Thank You to Zincubus For This Useful Post:

    GoingPostal (02-14-2020)

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1