Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 474

1 members and 473 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.


» Today's Birthdays

» Stats

Members: 70,094
Threads: 244,288
Posts: 2,532,462
Top Poster: JLC (31,651)
Welcome to our newest member, Davidt29
Page 1 of 3 123 LastLast
Results 1 to 10 of 27
  1. #1
    BPnet Veteran Luvyna's Avatar
    Join Date
    01-06-2019
    Posts
    674
    Thanks
    954
    Thanked 610 Times in 377 Posts

    Which snake is the weirdest?

    We've had the "which snake looks the most evil" and "which snake is the cutest" threads, but what about which snake is the weirdest?

    I only recently discovered that the Arabian sand boa is a real animal and not just a crazy Photoshop job so that's what inspired this post.


  2. The Following 5 Users Say Thank You to Luvyna For This Useful Post:

    Craiga 01453 (02-12-2020),dakski (02-12-2020),Reinz (02-12-2020),richardhind1972 (02-12-2020),Southpaw91 (02-13-2020)

  3. #2
    Moderator Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    12,954
    Thanks
    18,276
    Thanked 10,720 Times in 6,835 Posts
    So by "weirdest" snake, you're referring to appearance? I wasn't sure if you meant "behavior" or just what?

    That Arabian sand boa is a pretty good contender, btw...those eyes look like they were glued on.
    Last edited by Bogertophis; 02-12-2020 at 12:11 AM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  4. The Following User Says Thank You to Bogertophis For This Useful Post:

    lew-e (02-12-2020)

  5. #3
    BPnet Veteran Luvyna's Avatar
    Join Date
    01-06-2019
    Posts
    674
    Thanks
    954
    Thanked 610 Times in 377 Posts
    Both appearance and behaviour count! I want to learn about all the weird snakes haha

  6. #4
    Moderator Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    12,954
    Thanks
    18,276
    Thanked 10,720 Times in 6,835 Posts
    I'd vote for this guy (Rhino rat snake, pic borrowed from recent "Long Boi" thread in general colubrids category). I think they look like
    the cross between a snake & a unicorn, lol.

    Quote Originally Posted by Zincubus View Post
    Mmmm .. how about this little fella ??
    Quote Originally Posted by Zincubus View Post






    Sent from my iPhone using Tapatalk Pro
    Last edited by Bogertophis; 02-12-2020 at 12:22 AM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  7. The Following 8 Users Say Thank You to Bogertophis For This Useful Post:

    dr del (02-13-2020),GoingPostal (02-14-2020),Luvyna (02-12-2020),Reinz (02-12-2020),richardhind1972 (02-12-2020),Sonny1318 (02-12-2020),tickyyy (02-12-2020),Zincubus (02-12-2020)

  8. #5
    BPnet Lifer Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,367
    Thanks
    2,345
    Thanked 4,228 Times in 2,647 Posts

    Re: Which snake is the weirdest?

    Quote Originally Posted by Bogertophis View Post
    I'd vote for this guy (Rhino rat snake, pic borrowed from recent "Long Boi" thread in general colubrids category). I think they look like
    the cross between a snake & a unicorn, lol.
    Following on from the above

    I’d say that Rhino nosed Rat snakes are quite possibly THE perfect snake .. they start off as tiny GREY worms and in twelve months they’re two foot long GREEN godlike snakes

    Great display snakes that are active seemingly 24/7 .. good to handle , slow moving and placid , great appetite, spend a decent chunk of time climbing and resting in branches and the rest under water !
    Mine actually ate underwater more often than not !!



    Sent from my iPhone using Tapatalk Pro




  9. The Following 3 Users Say Thank You to Zincubus For This Useful Post:

    Bogertophis (02-12-2020),Luvyna (02-12-2020),Reinz (02-12-2020)

  10. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    882
    Thanks
    94
    Thanked 665 Times in 359 Posts
    Dragon snake...

    Iranian spider-tailed viper...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (02-12-2020),Luvyna (02-12-2020)

  12. #7
    BPnet Veteran Blitzjg's Avatar
    Join Date
    07-01-2013
    Location
    Detroit, MI
    Posts
    234
    Thanks
    20
    Thanked 12 Times in 9 Posts
    Is it true that dragon snakes aren't able to be kept in captivity successfully?

    1.0 Link, my Abbott Okeetee corn snake
    1.0 Pit, my Yellow-belly ball python
    1.1 Ramza and Midna, my kittens

  13. #8
    Moderator Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    12,954
    Thanks
    18,276
    Thanked 10,720 Times in 6,835 Posts

    Re: Which snake is the weirdest?

    Quote Originally Posted by Blitzjg View Post
    Is it true that dragon snakes aren't able to be kept in captivity successfully?
    Sadly yes, that's what I've read too, but eventually someone may figure out how to?
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  14. #9
    BPnet Senior Member dakski's Avatar
    Join Date
    02-08-2014
    Location
    Connecticut
    Posts
    3,877
    Thanks
    5,902
    Thanked 7,105 Times in 3,020 Posts
    Blog Entries
    1
    Images: 134

    Re: Which snake is the weirdest?

    Weird, but adorable, are hognose. Love them, but don't keep them.

  15. The Following User Says Thank You to dakski For This Useful Post:

    Luvyna (02-13-2020)

  16. #10
    BPnet Veteran Luvyna's Avatar
    Join Date
    01-06-2019
    Posts
    674
    Thanks
    954
    Thanked 610 Times in 377 Posts

    Re: Which snake is the weirdest?

    Quote Originally Posted by Bogertophis View Post
    I'd vote for this guy (Rhino rat snake, pic borrowed from recent "Long Boi" thread in general colubrids category). I think they look like
    the cross between a snake & a unicorn, lol.
    I remember seeing this guy in the "Long Boi" thread! I love his unicorn horn and how it has scales on it! Would be funny to see how these guys start their sheds and eat, does the horn get in the way? It looks like he told too many lies so his nose grew longer and longer like Pinocchio's

    Also I found another snake species with a hilariously long "nose":



    The Malagasy leaf-nosed snake!

    Quote Originally Posted by Zincubus View Post
    Following on from the above

    I’d say that Rhino nosed Rat snakes are quite possibly THE perfect snake .. they start off as tiny GREY worms and in twelve months they’re two foot long GREEN godlike snakes

    Great display snakes that are active seemingly 24/7 .. good to handle , slow moving and placid , great appetite, spend a decent chunk of time climbing and resting in branches and the rest under water !
    Mine actually ate underwater more often than not !!

    Sent from my iPhone using Tapatalk Pro
    Thanks for the info, that is so cool to know! You're really selling me on these snakes now haha, I may even look into getting one someday now.

    Quote Originally Posted by asplundii View Post
    Dragon snake...

    Iranian spider-tailed viper...
    Okay, I thought BPs had the cutest faces but I WAS WRONG, the dragon snake takes the cake:



    Look at that cute "smile"! And they are really cool looking too, they really do look like dragons

    Iranian spider-tailed vipers are super cool as well, very interesting tails for luring in prey:


  17. The Following User Says Thank You to Luvyna For This Useful Post:

    Bogertophis (02-13-2020)

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1