Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,788

0 members and 2,788 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,078
Threads: 248,524
Posts: 2,568,615
Top Poster: JLC (31,651)
Welcome to our newest member, RaginBull
Page 2 of 2 FirstFirst 12
Results 11 to 12 of 12
  1. #11
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Finally got some acid!

    He came in this morning and I am quite happy! He looks even better in person. Can't wait to start pairing him up next year. I just love how this gene is so different than anything else other than confusion and static of course lol. The belly patterns it makes I'm so overwhelmed with the possibilities! Should be an exciting next couple years.

    Sent from my SM-J737V using Tapatalk

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Finally got some acid!

    Quote Originally Posted by rufretic View Post
    As for the albino vs clown, that doesn't really concern me because my recessive of choice is desert ghost so expect to see acid DG combos in the near future
    Also not a bad direction to take.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    rufretic (02-13-2020)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1