Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 183

10 members and 173 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.


» Today's Birthdays

None

» Stats

Members: 67,264
Threads: 241,881
Posts: 2,510,784
Top Poster: JLC (31,651)
Welcome to our newest member, Ocean_Drive_Royals
Results 1 to 5 of 5
  1. #1
    Registered User LemonDroops's Avatar
    Join Date
    10-08-2019
    Posts
    6
    Thanks
    0
    Thanked 1 Time in 1 Post

    (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    I want to set up a bio active vivarium for my ball pythons and Mexican black king snake. I have four terrariums in total. I highlighted my questions and organized them into categories.

    40 gallon (Female Ball Python)
    40 gallon (Female Ball Python)
    30 gallon (Male Ball Python)
    10 gallon (Mexican Black King Snake)


    ISOPODS: I have 30 powder blue and 100 dwarf white isopods in total. How many isopods should I use for each terrarium? Should I continuously add more over time to ensure they colonize successfully in my terrariums? Once they are in there, should I do anything else other than add leaf litter/ cork bark to help them survive?

    ISOPOD CARE:
    I currently have the isopods in separate containers. (Blue top for POWDER BLUES and red top for WHITE DWARFS) pics below. I don't have any palm bark so am using cork. I boiled leaves I gathered from outside (Maple & Oak). The substrate is coco fiber with sphagnum moss and I make sure to maintain the humidity in the dwarf white container. Is there anything I can do to improve my cultures? Are there any other ways to sterilize leaves?

    SPRING TAILS: I currently don't have any on hand but hope to find some at the reptile convention later this month. How many should I add into each terrarium? Do you know where I could get some now in Canada? Would it be ok if I add the isopods before the spring tails?

    SCALE ROT: As I'm doing research, I find that scale rot becomes an issue when it comes to bio active set ups. I added lots of substrate to ensure there were layers for water to drain down so the top would stay dry (pics below of my tanks). How else can I protect my snakes from scale rot? Are there any other risks I should take in account other than scale rot?

    MY SETUP:
    I want my snakes to have a natural experience and full life in captivity. I don't just want them to survive but to thrive instead. I have artificial plants as I don't get sufficient sunlight in my room but I would be happy to add low light plants, I just haven't found any good ones yet. Is there anything I can add to my terrariums to enrich their experience or overall improve their health? Are there any low light plants that you've had success with?

    SPOT CLEANING:
    I find that some people choose to take out feces while some leave them in the setup, same with urate. I thought the clean up crew would be responsible for breaking down the waste. What should I take out when I spot clean? Should I ever remove the decorations and scrub them clean?

    Thank you for your time & response in advance. If you see any fault or flaw in my care, please let me know. I always believe there is room for improvement and would appreciate your honest opinion.




  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    835
    Thanks
    85
    Thanked 609 Times in 330 Posts

    Re: (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    Quote Originally Posted by LemonDroops View Post
    How many isopods should I use for each terrarium? Should I continuously add more over time to ensure they colonize successfully in my terrariums? Once they are in there, should I do anything else other than add leaf litter/ cork bark to help them survive?
    If your set up is done properly then you should only need to add them once and they will begin to reproduce on their own and become self sustaining. How many you add depends on how quickly you want a sizable population to establish and how much you want to spend. If you are willing to throw $100 into each cage then get multiple colonies and they should stabilize pretty quickly. If you only have $10 to put into each cage then it will take longer until their population really takes hold


    Quote Originally Posted by LemonDroops View Post
    ISOPOD CARE: [/B]I currently have the isopods in separate containers. (Blue top for POWDER BLUES and red top for WHITE DWARFS) pics below. I don't have any palm bark so am using cork. I boiled leaves I gathered from outside (Maple & Oak). The substrate is coco fiber with sphagnum moss and I make sure to maintain the humidity in the dwarf white container. Is there anything I can do to improve my cultures? Are there any other ways to sterilize leaves?
    Leaves and cork are fine. If you want to throw the occasional carrot or sweet potato slice in you can do that but that also increases the odds of fungus and gnats and stuff.

    Boiling is the best way to sterilize but you can also bake them in the oven at 200F for a couple hours. Just stay in the kitchen while you do that because sometimes they can catch fire.



    Quote Originally Posted by LemonDroops View Post
    SPRING TAILS: I currently don't have any on hand but hope to find some at the reptile convention later this month. How many should I add into each terrarium? Do you know where I could get some now in Canada? Would it be ok if I add the isopods before the spring tails?
    See above re: How many isopods to add. And it is fine to add the isopods first, they are not going to out-compete the springs


    Quote Originally Posted by LemonDroops View Post
    SCALE ROT: As I'm doing research, I find that scale rot becomes an issue when it comes to bio active set ups. I added lots of substrate to ensure there were layers for water to drain down so the top would stay dry (pics below of my tanks). How else can I protect my snakes from scale rot? Are there any other risks I should take in account other than scale rot?
    Scale rot comes from sitting in excess moisture and urates. If you are keeping the enclosure correctly you should not have either.


    Quote Originally Posted by LemonDroops View Post
    MY SETUP: I want my snakes to have a natural experience and full life in captivity. I don't just want them to survive but to thrive instead. I have artificial plants as I don't get sufficient sunlight in my room but I would be happy to add low light plants, I just haven't found any good ones yet. [B]Is there anything I can add to my terrariums to enrich their experience or overall improve their health? Are there any low light plants that you've had success with?
    English ivy varieties and pothos do well in low light. Added bonus that their vining growth means you can start with a small piece and they spread. Only caution I would add here is that you probably want to let them establish in and grow before adding the snakes because fresh cuttings and active snakes makes for cuttings that get plowed around and do not root


    Quote Originally Posted by LemonDroops View Post
    SPOT CLEANING: I find that some people choose to take out feces while some leave them in the setup, same with urate. I thought the clean up crew would be responsible for breaking down the waste. What should I take out when I spot clean? Should I ever remove the decorations and scrub them clean?
    Bioactive is not self-cleaning, especially with larger animals like snakes. If you see urates/feces then remove them. The clean-up crews are in place to help with the small amounts that you cannot clean or miss when cleaning
    Last edited by asplundii; 02-06-2020 at 09:36 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    Aerries (02-06-2020)

  4. #3
    Registered User wnateg's Avatar
    Join Date
    07-25-2019
    Location
    TX
    Posts
    480
    Thanks
    430
    Thanked 483 Times in 248 Posts
    Last edited by wnateg; 02-06-2020 at 01:53 PM.
    0.1.0 Cat "Anna"
    -----
    0.1.0 Emerald Tree Boa "Samantha"
    0.1.0 Merauke Scrub Python "Victoria"
    0.1.0 Titanium Reticulated Python "Alice"
    -----
    0.0.1 Antilles Pink Toe Tarantula "Katherine"
    -----
    0.0.1 Alligator Snapping Turtle "Deborah"


  5. #4
    BPnet Veteran Aerries's Avatar
    Join Date
    02-16-2017
    Location
    Kissimmee Fl
    Posts
    896
    Thanks
    305
    Thanked 839 Times in 422 Posts
    Images: 16

    Re: (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    Quote Originally Posted by asplundii View Post
    If your set up is done properly then you should only need to add them once and they will begin to reproduce on their own and become self sustaining. How many you add depends on how quickly you want a sizable population to establish and how much you want to spend. If you are willing to throw $100 into each cage then get multiple colonies and they should stabilize pretty quickly. If you only have $10 to put into each cage then it will take longer until their population really takes hold




    Leaves and cork are fine. If you want to throw the occasional carrot or sweet potato slice in you can do that but that also increases the odds of fungus and gnats and stuff.

    Boiling is the best way to sterilize but you can also bake them in the oven at 200F for a couple hours. Just stay in the kitchen while you do that because sometimes they can catch fire.





    See above re: How many isopods to add. And it is fine to add the isopods first, they are not going to out-compete the springs




    Scale rot comes from sitting in excess moisture and urates. If you are keeping the enclosure correctly you should not have either.




    English ivy varieties and pothos do well in low light. Added bonus that their vining growth means you can start with a small piece and they spread. Only caution I would add here is that you probably want to let them establish in and grow before adding the snakes because fresh cuttings and active snakes makes for cuttings that get plowed around and do not root




    Bioactive is not self-cleaning, especially with larger animals like snakes. If you see urates/feces then remove them. The clean-up crews are in place to help with the small amounts that you cannot clean or miss when cleaning
    I can say that is 100% accurate. I have my Normal Ball- Ramsey in a Bioactive with spring tails, Powder Orange, and Dwarf White ISO’s and all I do is spray the pothos once a week and spot clean any urates and poos.....substrate is a combo of potting soil, coconut fibre, and cypress, with sphagnum moss and leaf litter.....it’s a total game changer. I waited two weeks but I breed my own ISO’s and spring tails so I dumped a lot to better establish quicker. As far as the pathos....they’re exploding and they were clipping from my Pixie frogs enclosure and are doing amazingly


    Sent from my iPhone using Tapatalk

  6. #5
    Registered User Naginii's Avatar
    Join Date
    09-07-2019
    Posts
    46
    Thanks
    8
    Thanked 29 Times in 21 Posts

    Re: (HELP w/ Isopods) BIO ACTIVE VIVARIUM

    Quote Originally Posted by LemonDroops View Post


    MY SETUP:
    I want my snakes to have a natural experience and full life in captivity. I don't just want them to survive but to thrive instead. I have artificial plants as I don't get sufficient sunlight in my room but I would be happy to add low light plants, I just haven't found any good ones yet. Is there anything I can add to my terrariums to enrich their experience or overall improve their health? Are there any low light plants that you've had success with?

    SPOT CLEANING:
    I find that some people choose to take out feces while some leave them in the setup, same with urate. I thought the clean up crew would be responsible for breaking down the waste. What should I take out when I spot clean? Should I ever remove the decorations and scrub them clean?



    I can't answer everything but it seems like you have gotten some good advice anyways. I wanted to touch on these two questions though. A spider plant is a wonderful low light plant. I have kept them in darker shelves in my office with super indirect light and they still grow like champs. They do send out runners once established and you may have to take those runners out if you find yourself short on space. They do well with constant moist soil or dry periods. I just love them! Plus they look neat lol.

    I would say to spot clean until your colony is fully established and after that, take out anything still left after 24 hours. That's my plan anyways. I've heard of people not needing to spot clean with a really mature clean up crew but I can't personally attest to that as I am just getting started myself. You shouldn't ever have to remove decorations to scrub them, anything like mold or fungi should be eaten by the clean up crew and all I can see it doing is removing bacteria that you probably want in the tank. Hope this helps!

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1