Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,744

4 members and 2,740 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,083
Threads: 248,525
Posts: 2,568,638
Top Poster: JLC (31,651)
Welcome to our newest member, NopeRopeMD
Results 1 to 5 of 5
  1. #1
    Registered User
    Join Date
    01-04-2020
    Posts
    11
    Thanks
    0
    Thanked 1 Time in 1 Post

    Spotnose question

    Hello all,

    I have been trying to figure out a couple things about the spotnose and am wondering if anyone can simplify it for me.

    First, is the Spotnose part of the spider complex?

    Second do they have a head wobble normally or only in the super form?

    Thank you for your help.

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spotnose question

    Quote Originally Posted by PaysonHobbyist View Post
    First, is the Spotnose part of the spider complex?
    There is no data that I have seen to show one way or another. I have not seen a BH Spotnose made let alone bred out so... That would be all that is needed to answer the question


    Quote Originally Posted by PaysonHobbyist View Post
    Second do they have a head wobble normally or only in the super form?
    Wobble has only been reported in the superform to my knowledge.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    Registered User
    Join Date
    01-04-2020
    Posts
    11
    Thanks
    0
    Thanked 1 Time in 1 Post

    Re: Spotnose question

    Thank you for answering my questions.

    I am a little confused, though. Why would a BH Spotnose being made answer whether or not a Spotnose is part of the Spider complex?

    Thank you for your help and explanations.

  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spotnose question

    Quote Originally Posted by PaysonHobbyist View Post
    Thank you for answering my questions.
    Happy to help where I can


    Quote Originally Posted by PaysonHobbyist View Post
    I am a little confused, though. Why would a BH Spotnose being made answer whether or not a Spotnose is part of the Spider complex?
    Since the Spider/Spot is terminal, you are not going to get one to grow up and breed out to determine if Spotnose is in the same complex. However, Blackhead and Spider are alleles. So you accomplish the same thing, first by make a BH/Spot and then, by breeding it out. If the clutch produced only Spotnose and BH with no normals and no BH/Spot, then you can conclude it is part of the Spider complex

    Make sense?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following User Says Thank You to asplundii For This Useful Post:

    rufretic (02-11-2020)

  6. #5
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Spotnose question

    Quote Originally Posted by asplundii View Post
    Happy to help where I can




    Since the Spider/Spot is terminal, you are not going to get one to grow up and breed out to determine if Spotnose is in the same complex. However, Blackhead and Spider are alleles. So you accomplish the same thing, first by make a BH/Spot and then, by breeding it out. If the clutch produced only Spotnose and BH with no normals and no BH/Spot, then you can conclude it is part of the Spider complex

    Make sense?

    Interesting. I have spotnose and black head in my DG project, maybe something to think about for the future.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1