Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,909

1 members and 2,908 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,078
Threads: 248,524
Posts: 2,568,615
Top Poster: JLC (31,651)
Welcome to our newest member, RaginBull
Results 1 to 3 of 3

Thread: Fading albinos

  1. #1
    Registered User threadgoode's Avatar
    Join Date
    03-19-2018
    Posts
    36
    Thanks
    61
    Thanked 14 Times in 7 Posts
    Images: 9

    Fading albinos

    How faded do albinos usually get? I'm curious because a breeder friend of mine was surprised how different my girl looks since he last saw her as a 5 month-old. She turned 2 in November, and below is a comparison pic from when I got her vs. her latest post-shed. Lots of bleeding on top, and she got darker as well. Looks quite a bit like cheddar cheese now, actually!

    Sent from my SM-N960U using Tapatalk

  2. The Following User Says Thank You to threadgoode For This Useful Post:

    Ronniex2 (07-18-2022)

  3. #2
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    The yellow bleeding into the white really varies from one individual to another, I have sold a proven female years ago with little to no bleeding, than again that female was a tiger albino (genetic reduced pattern) so it may have help.

    A lot of Albino and most combos will do that sadly often leaving you with a yellow snake, the best combos to that prevent that are Black Pastel Albino and Albino Pied (also there the yellow is bleeding in the saddle markings it does bleed anywhere where else leaving you with a white and yellow snake)
    Deborah Stewart


  4. The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    Ronniex2 (07-18-2022),threadgoode (01-06-2020)

  5. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Fading albinos

    As mentioned, some Albinos just bleed through, it is about the line-breeding that has gone into the animal. Most "high contrast" animals will have minimal bleeding because of the secondary traits you are selecting for (e.g., minimal blushing)


    Quote Originally Posted by Stewart_Reptiles View Post
    the best combos to that prevent that are Black Pastel Albino and Albino Pied
    To this list I would add Albino Woma, and Albino Acid. I have representative animals of both that are over 1200g and have the contrast of fresh hatchlings. I have also seen Albino Leopard animals that have held contrast well
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    threadgoode (01-06-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1