» Site Navigation
2 members and 2,734 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,079
Threads: 248,524
Posts: 2,568,622
Top Poster: JLC (31,651)
|
-
Registered User
Black Morphs?
I was wondering if there was a black morph for BPs that's actually black? I know there's a "Super Sable" but that morph is a no-no, and it's not actually black, it's brown. I also know Axanthic is an option, but I'm talking more of a morph that has no marking on it - like the blue eyed leucistic gene - to give it that jet black appearance. I've tried finding some; looking through MorphMarket, threads on here, and google, but a lot of the solid black BPs have not been actual BPs or have been photo-shopped.
Am I just dumb?
Thank y'all in advance for the help! And sorry if this has already been asked.
Fasfer
"God put the good things in life on the other side of fear..."
-Will Smith
-
-
Registered User
Re: Black Morphs?
A lot of the solid black morphs have some risk of birth defects, mainly kinking of the spine. A super mahogany would be a good choice if you want a very dark snake with out the risk.
-
The Following User Says Thank You to AzJohn For This Useful Post:
-
Registered User
Re: Black Morphs?
Yeah, I found some info on the Super Black Pastels having severe issues: kinks, wobbles etc.. So bad in some cases, a few breeders even have them marked as a "Lethal" morph, which is unfortunate because they are gorgeous snakes. I just didn't know if there was any that were worth getting, that wouldn't support the breeding of bad genes and gene traits. This helps, though! I'll definitely check 'em out.
Fasfer
"God put the good things in life on the other side of fear..."
-Will Smith
-
-
-
The Following 3 Users Say Thank You to Hannahshissyfix For This Useful Post:
Kam (12-20-2019),ladywhipple02 (12-18-2019),Ronniex2 (08-12-2021)
-
So far, even the darkest looking combos as babies have grown up to be more deep brown as adults. I JKR's original SUMA Cinny at NARBC four years ago and it was deep black but as it matured it browned out with the ontogenic change. The SUMA GHI was, likewise, a very dark animal but it had traces of pattern on it and the last pic I saw of it it was also starting to get that brown tone to it.
I would suspect that tadding something like Axanthic or DesertGhost, which act to strip down some of the xanthin expression, would work to make a cleaner/darker combo as an adult but the only way to know for sure would be to make it and see
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|