Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 644

5 members and 639 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.

» Today's Birthdays

05RKClass (46)

» Stats

Members: 71,352
Threads: 245,403
Posts: 2,543,850
Top Poster: JLC (31,651)
Welcome to our newest member, ekolodziejski
Results 1 to 4 of 4
  1. #1
    BPnet Veteran Moose84's Avatar
    Join Date
    04-20-2019
    Posts
    291
    Thanks
    122
    Thanked 267 Times in 136 Posts

    Feeders in Northern Virginia

    I'm looking to see how many people in Northern Virginia are looking for / in need of live feeders or FT for that matter. As my collection grows I find it harder and harder to find a supplier to handle the collection. Nova is a populated area and I have a few ideas that could help out but I just need to find some others locally to bounce ideas off. If anyone is in the NOVA area and this sounds like something that interests you please let me know.

  2. #2
    BPnet Veteran
    Join Date
    07-07-2019
    Posts
    473
    Thanks
    17
    Thanked 368 Times in 244 Posts
    Images: 8
    Check the book of face local market or VA rodent breeders. That's how I found my ASF an fancy rats. If you where on the Eastern Shore of VA I could hook you up
    Do you have the room for one or twp racks? You'd be set.
    Plans I used, but with 1/4" wire an I use hoppers to feed.
    http://www.arbreptiles.com/cages/rat_rack.html

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    893
    Thanks
    97
    Thanked 684 Times in 368 Posts
    Where in NoVA are you?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #4
    BPnet Veteran Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    695
    Thanks
    464
    Thanked 925 Times in 443 Posts

    Re: Feeders in Northern Virginia

    I believe I'm close to you....

    I don't use live, and haven't had to yet (fingers crossed)

    I do use f/t, but just ordered 6 months worth from Perfect Prey, so I'm good for a while now, but do have 6 snakes to feed.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1