Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 237

14 members and 223 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

» Stats

Members: 68,689
Threads: 243,190
Posts: 2,522,976
Top Poster: JLC (31,651)
Welcome to our newest member, Lavenderlovender13
Results 1 to 4 of 4
  1. #1
    Registered User Moose84's Avatar
    Join Date
    04-20-2019
    Posts
    290
    Thanks
    121
    Thanked 266 Times in 136 Posts

    Feeders in Northern Virginia

    I'm looking to see how many people in Northern Virginia are looking for / in need of live feeders or FT for that matter. As my collection grows I find it harder and harder to find a supplier to handle the collection. Nova is a populated area and I have a few ideas that could help out but I just need to find some others locally to bounce ideas off. If anyone is in the NOVA area and this sounds like something that interests you please let me know.

  2. #2
    Registered User
    Join Date
    07-07-2019
    Posts
    266
    Thanks
    9
    Thanked 175 Times in 124 Posts
    Images: 4
    Check the book of face local market or VA rodent breeders. That's how I found my ASF an fancy rats. If you where on the Eastern Shore of VA I could hook you up
    Do you have the room for one or twp racks? You'd be set.
    Plans I used, but with 1/4" wire an I use hoppers to feed.
    http://www.arbreptiles.com/cages/rat_rack.html

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    866
    Thanks
    91
    Thanked 650 Times in 350 Posts
    Where in NoVA are you?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #4
    Registered User Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    453
    Thanks
    339
    Thanked 581 Times in 274 Posts

    Re: Feeders in Northern Virginia

    I believe I'm close to you....

    I don't use live, and haven't had to yet (fingers crossed)

    I do use f/t, but just ordered 6 months worth from Perfect Prey, so I'm good for a while now, but do have 6 snakes to feed.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1