Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 294

8 members and 286 guests
Most users ever online was 5,577, 11-08-2019 at 08:53 AM.


» Today's Birthdays

dneldm (30)

» Stats

Members: 66,393
Threads: 241,155
Posts: 2,504,633
Top Poster: JLC (31,651)
Welcome to our newest member, LexLou
Results 1 to 5 of 5
  1. #1
    Registered User
    Join Date
    04-08-2019
    Posts
    24
    Thanks
    2
    Thanked 5 Times in 3 Posts

    Silver ball on reddit. What is it?

    Found a post on reddit:
    https://www.reddit.com/r/interesting...h_ball_python/

    That seems to show a shiny silver snake...


    What on earth is this morph? I'm guessing super cinnamon/black pastel is involved.
    One reply seemed to think it's only shiny because he hasn't shed yet, but either way it's a really amazing color.

  2. #2
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,419 Times in 2,889 Posts
    Images: 22

    Re: Silver ball on reddit. What is it?

    any snake with that kind of shine is a hatchling that has yet to shed.

    just reverse image search. id do it for you but im on mobile.


    EDIT: noticable duck-billing, likely super cinny+
    Last edited by tttaylorrr; 11-11-2019 at 10:57 PM.
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  3. The Following User Says Thank You to tttaylorrr For This Useful Post:

    Bogertophis (11-12-2019)

  4. #3
    Registered User RedRabbit's Avatar
    Join Date
    11-04-2018
    Location
    Southern California
    Posts
    340
    Thanks
    226
    Thanked 526 Times in 226 Posts
    Images: 30
    I remember seeing this picture before, or one quite like it. It's a Silver Bullet ball python, or Super Cinnamon Pastel. (And yes, as tttaylorrr mentioned, the wet shine on it is just because it's a new hatchling.)
    Last edited by RedRabbit; 11-12-2019 at 02:42 AM.
    Ball Pythons:
    2018 Cinnamon Enchi Ghost - Ignis ("Iggy")
    2018 Butter Mojave BEL - Ravus ("Rae")

    Boa Imperator:
    2018 Hypo Blood - Genesis ("Gen")
    2019 IMG Motley - Requiem ("Q")

    Iggy&Rae on Instagram:
    https://www.instagram.com/iggy_and_rae

  5. #4
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,366
    Thanks
    6,001
    Thanked 19,901 Times in 9,240 Posts
    Blog Entries
    1
    Images: 6
    Silver bullet.
    Deborah Stewart

  6. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    816
    Thanks
    85
    Thanked 591 Times in 319 Posts
    Given that background I am guessing it was produced by Corey Woods
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1