Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 762

6 members and 756 guests
Most users ever online was 5,577, 11-08-2019 at 08:53 AM.


» Today's Birthdays

Finn0208 (44)

» Stats

Members: 66,100
Threads: 240,839
Posts: 2,501,824
Top Poster: JLC (31,651)
Welcome to our newest member, hebihime
Results 1 to 6 of 6
  1. #1
    Registered User
    Join Date
    08-15-2019
    Posts
    1
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Granite and asphalts?

    I think both have the YB gene in them, but what is the difference btwn them and they are made by what pairing?

    Thanks,
    mike

  2. #2
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-19-2016
    Location
    Asheville, NC, USA
    Posts
    2,353
    Thanks
    3,236
    Thanked 2,075 Times in 1,180 Posts

    Re: Granite and asphalts?

    Granite is a genetic morph all on its own. Asphalt is also a single gene morph allellic to yellow belly but different.


    Kaos Balls

  3. The Following User Says Thank You to Godzilla78 For This Useful Post:

    rufretic (10-19-2019)

  4. #3
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,248
    Thanks
    8,554
    Thanked 6,552 Times in 4,167 Posts
    Images: 92

    Re: Granite and asphalts?

    To clarify what that means here is a double gene yellowbelly.

    Link to a good page.

    And here is the result of a yellowbelly asphalt.

    Link.

    And the yellowbelly granite.

    link.


    So while they are not the same morph they exist on the same genetic location ( called allellic )


    And this means a freeway bred to a normal will produce only yellowbellies and asphalt but no normals and no freeways.




    del
    Last edited by dr del; 10-19-2019 at 10:37 PM.
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  5. The Following User Says Thank You to dr del For This Useful Post:

    Godzilla78 (10-19-2019)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    806
    Thanks
    84
    Thanked 562 Times in 312 Posts
    Just going to clarify that I believe that the OP means Gravel and not Granite

    Gravel is allelic with the YB group

    Granite is a wholly unrelated morph
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Godzilla78 (11-03-2019)

  8. #5
    Registered User Copperman05's Avatar
    Join Date
    09-11-2019
    Posts
    16
    Thanks
    12
    Thanked 19 Times in 8 Posts
    In layman's terms they are all very similar visually as single genes, a kind of sub trait of the yellow belly gene. But which when bred together produce different results.

    Yellow Belly X Yellow Belly = Super yellow belly (more commonly known as an Ivory).

    Gravel X Yellow Belly = Highway

    Asphalt X Yellow Belly = Freeway

    There are also at least two other similar genes.

    Spark X Yellow Belly = Puma

    Specter X Yellow Belly = Superstripe

    Hope this helps?
    Last edited by Copperman05; 10-21-2019 at 02:53 PM.

  9. The Following User Says Thank You to Copperman05 For This Useful Post:

    dr del (10-21-2019)

  10. #6
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,248
    Thanks
    8,554
    Thanked 6,552 Times in 4,167 Posts
    Images: 92

    Re: Granite and asphalts?

    Quote Originally Posted by asplundii View Post
    Just going to clarify that I believe that the OP means Gravel and not Granite

    Gravel is allelic with the YB group

    Granite is a wholly unrelated morph
    Good point - I should go to bed earlier to avoid making these mistakes.
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1