Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 983

15 members and 968 guests
Most users ever online was 4,261, 10-01-2019 at 06:44 PM.


» Today's Birthdays

None

» Stats

Members: 65,844
Threads: 240,537
Posts: 2,499,149
Top Poster: JLC (31,651)
Welcome to our newest member, jaymims
Page 4 of 4 FirstFirst 1234
Results 31 to 40 of 40
  1. #31
    BPnet Veteran Craiga 01453's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    8,961
    Thanks
    11,407
    Thanked 8,229 Times in 4,208 Posts

    Re: Uncommon/Underrated Snakes?

    Quote Originally Posted by scobro View Post
    That would be cool to see.

    I've always like the look of a Mandarin Rat. Never seen one first hand but the videos et al, the yellow and black is just radiant. And I'm not even a Steelers fan.
    Mandarins are gorgeous!!! I love the black and yellow, it just pops so beautifully.
    Mangroves are another I'd like to see more commonly in captivity. Another example of beautiful black and yellow.

    No Steelers fan here either (Go Pats!!) but I am a die hard Boston Bruins fan! So the black and yellow works there!!
    ...life is beautiful...

    0.1 Bredli Python - Fernie
    1.0 Vanilla het Pied BP - Tyson
    1.0 Pastel Fader BP - Dembe
    1.0 California Kingsnake - Django
    1.0 Western Hognose - Cosmo
    1.0 Borneo Short Tail Python - Juice
    1.0 Anery Kenyan Sando Boa - Willow
    2.2 Ferrets - Baloo, Johnny & June and Chloe
    0.2 Cats - Simba & Nala

  2. #32
    Registered User wnateg's Avatar
    Join Date
    07-25-2019
    Location
    TX
    Posts
    191
    Thanks
    209
    Thanked 163 Times in 99 Posts

    Re: Uncommon/Underrated Snakes?

    Quote Originally Posted by Craiga 01453 View Post
    I stand corrected. Apologies.

    And I was under the belief that drop for drop their venom is among the most lethal. If I'm wrong I apologize. I try not to share info unless I'm confident I'm right. There's already enough false info on the internet, I don't need to be adding to it. Hahhahaa.
    I was doing reading about gaboon vipers, and they have the "highest venom yield of any snake."

    That might be what you're thinking of.
    0.1.0 Cat "Anna"
    -----
    0.0.1 Emerald Tree Boa "Samantha"
    0.1.0 Jayapura Scrub Python "Victoria"
    -----
    0.0.1 Antilles Pink Toe Tarantula "Katherine"
    -----
    0.0.1 Alligator Snapping Turtle "Deborah"


  3. The Following User Says Thank You to wnateg For This Useful Post:

    Craiga 01453 (10-08-2019)

  4. #33
    BPnet Veteran Craiga 01453's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    8,961
    Thanks
    11,407
    Thanked 8,229 Times in 4,208 Posts

    Re: Uncommon/Underrated Snakes?

    Quote Originally Posted by wnateg View Post
    I was doing reading about gaboon vipers, and they have the "highest venom yield of any snake."

    That might be what you're thinking of.
    Thank you. I knew I saw something along those lines.
    ...life is beautiful...

    0.1 Bredli Python - Fernie
    1.0 Vanilla het Pied BP - Tyson
    1.0 Pastel Fader BP - Dembe
    1.0 California Kingsnake - Django
    1.0 Western Hognose - Cosmo
    1.0 Borneo Short Tail Python - Juice
    1.0 Anery Kenyan Sando Boa - Willow
    2.2 Ferrets - Baloo, Johnny & June and Chloe
    0.2 Cats - Simba & Nala

  5. #34
    Registered User TopazEye's Avatar
    Join Date
    09-08-2019
    Posts
    54
    Thanks
    51
    Thanked 17 Times in 11 Posts
    Images: 1

    Re: Uncommon/Underrated Snakes?

    Quote Originally Posted by scobro View Post
    That would be cool to see.

    I've always like the look of a Mandarin Rat. Never seen one first hand but the videos et al, the yellow and black is just radiant. And I'm not even a Steelers fan.
    Those are stunning!
    1.0 Normal BP
    0.0.1 Albino Corn Snake

  6. #35
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    800
    Thanks
    83
    Thanked 561 Times in 311 Posts
    Savu pythons and Mandarin rats have already been mentioned but I will echo them.

    I would love to see more species of Oligodon other than purpurascens enter the hobby. Would be nice to see Rhamphiophis become more readily bred in captivity as well. Would also like to see alterna get back some of the respect they used to have back in the day.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    TopazEye (10-09-2019)

  8. #36
    BPnet Lifer ladywhipple02's Avatar
    Join Date
    07-26-2005
    Location
    Greensburg, Indiana
    Posts
    2,613
    Thanks
    391
    Thanked 862 Times in 357 Posts
    Images: 11

    Re: Uncommon/Underrated Snakes?

    Someone mentioned African House snakes and I agree... super under-rated and easy to keep. An albino African House snake has been on my list of wants for a bit, but I need to get my reptile room/office reorganized first.

  9. The Following User Says Thank You to ladywhipple02 For This Useful Post:

    TopazEye (10-09-2019)

  10. #37
    BPnet Veteran cletus's Avatar
    Join Date
    08-26-2016
    Location
    San Antonio, TX
    Posts
    1,997
    Thanks
    1,925
    Thanked 1,642 Times in 1,087 Posts
    Images: 55
    Those Mandarin Rats are awesome!!

  11. #38
    Registered User
    Join Date
    06-30-2019
    Posts
    8
    Thanks
    1
    Thanked 5 Times in 3 Posts
    I used to think, for the most part, all snakes were beautiful looking in their own way, but then I saw the Elephant Trunk snake; not all snakes are beautiful looking in their own way. That little bugger just looks wrong. They are uncommon, not sure about the underrated part.

    Does anyone know/like these flabby skinned creatures?

  12. #39
    BPnet Veteran Craiga 01453's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    8,961
    Thanks
    11,407
    Thanked 8,229 Times in 4,208 Posts

    Re: Uncommon/Underrated Snakes?

    Quote Originally Posted by scobro View Post
    I used to think, for the most part, all snakes were beautiful looking in their own way, but then I saw the Elephant Trunk snake; not all snakes are beautiful looking in their own way. That little bugger just looks wrong. They are uncommon, not sure about the underrated part.

    Does anyone know/like these flabby skinned creatures?
    Ha! Great reply! And I gotta agree, those buggers are, well... less than pretty. It almost looks like they never fully evolved or developed, hahaha.
    Last edited by Craiga 01453; 10-09-2019 at 10:52 AM.
    ...life is beautiful...

    0.1 Bredli Python - Fernie
    1.0 Vanilla het Pied BP - Tyson
    1.0 Pastel Fader BP - Dembe
    1.0 California Kingsnake - Django
    1.0 Western Hognose - Cosmo
    1.0 Borneo Short Tail Python - Juice
    1.0 Anery Kenyan Sando Boa - Willow
    2.2 Ferrets - Baloo, Johnny & June and Chloe
    0.2 Cats - Simba & Nala

  13. #40
    Registered User Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    135
    Thanks
    72
    Thanked 183 Times in 85 Posts

    Re: Uncommon/Underrated Snakes?

    Once I find a stable supply of quail eggs, (looking at a few stores nearby when I get a chance). I'm going to try to pickup

    a pair of Egg eating snakes, they can be housed together , and eat strictly smaller eggs. Chicken eggs are too big. hopefully next spring maybe

    still working on getting the 2 baby pythons I acquired a month ago stable and going before adding anymore.

    But I think these guys are really Cool.


  14. The Following 3 Users Say Thank You to Gocntry For This Useful Post:

    cletus (10-09-2019),John1982 (10-09-2019),TopazEye (10-09-2019)

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1