Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 337

20 members and 317 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 65,480
Threads: 240,193
Posts: 2,495,392
Top Poster: JLC (31,651)
Welcome to our newest member, thomasdigger92
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17
  1. #11
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    Re: This is not a woma?

    She said wage got him from a pet store and was sold to her a normal. Then she went to another one and she was told he was a woma


    Sent from my iPhone using Tapatalk

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    797
    Thanks
    83
    Thanked 557 Times in 308 Posts

    Re: This is not a woma?

    Quote Originally Posted by Luiibill View Post
    She said wage got him from a pet store and was sold to her a normal. Then she went to another one and she was told he was a woma
    Then in all likelihood he is just a normal and the other pet store did not know what they were talking about.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #13
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    Re: This is not a woma?

    Hm yea weíll see


    Sent from my iPhone using Tapatalk

  4. #14
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    Re: This is not a woma?

    It actually looks like a normal. I didnít even think they could look like that


    Sent from my iPhone using Tapatalk

  5. #15
    Registered User sur3fir3's Avatar
    Join Date
    03-07-2019
    Posts
    666
    Thanks
    186
    Thanked 322 Times in 187 Posts
    I gotta ask. Did you pay the woma price or the normal price?
    1.0 T- Blood Python - Sangre
    1.0 Kahl Albino 100% Het Anery - Floyd
    0.1 - Human - Nebraska Locality - Tiara

  6. #16
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    Re: This is not a woma?

    I bought her collection for a good price. Donít worry I got my moneys worth, I wasnít going for the woma at all, I was just told he was and kinda assumed for a while


    Sent from my iPhone using Tapatalk

  7. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    797
    Thanks
    83
    Thanked 557 Times in 308 Posts

    Re: This is not a woma?

    Quote Originally Posted by sur3fir3 View Post
    Did you pay the woma price or the normal price?
    At this point in the hobby, a single gene Woma is not really much different in price than a normal
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1