Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 185

11 members and 174 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

None

» Stats

Members: 69,240
Threads: 243,678
Posts: 2,527,247
Top Poster: JLC (31,651)
Welcome to our newest member, Dia Berry
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17
  1. #11
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: This is not a woma?

    She said wage got him from a pet store and was sold to her a normal. Then she went to another one and she was told he was a woma


    Sent from my iPhone using Tapatalk

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    875
    Thanks
    92
    Thanked 657 Times in 355 Posts

    Re: This is not a woma?

    Quote Originally Posted by Luiibill View Post
    She said wage got him from a pet store and was sold to her a normal. Then she went to another one and she was told he was a woma
    Then in all likelihood he is just a normal and the other pet store did not know what they were talking about.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #13
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: This is not a woma?

    Hm yea weíll see


    Sent from my iPhone using Tapatalk

  4. #14
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: This is not a woma?

    It actually looks like a normal. I didnít even think they could look like that


    Sent from my iPhone using Tapatalk

  5. #15
    Registered User
    Join Date
    03-07-2019
    Posts
    810
    Thanks
    206
    Thanked 473 Times in 249 Posts
    I gotta ask. Did you pay the woma price or the normal price?

  6. #16
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: This is not a woma?

    I bought her collection for a good price. Donít worry I got my moneys worth, I wasnít going for the woma at all, I was just told he was and kinda assumed for a while


    Sent from my iPhone using Tapatalk

  7. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    875
    Thanks
    92
    Thanked 657 Times in 355 Posts

    Re: This is not a woma?

    Quote Originally Posted by sur3fir3 View Post
    Did you pay the woma price or the normal price?
    At this point in the hobby, a single gene Woma is not really much different in price than a normal
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1