Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 306

12 members and 294 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 65,197
Threads: 239,873
Posts: 2,492,063
Top Poster: JLC (31,652)
Welcome to our newest member, Snazzy19
Results 1 to 7 of 7
  1. #1
    Registered User
    Join Date
    07-16-2019
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    This is not a woma?

    I was told he was a woma. But Iím not so sure as the lady that gave me him also claimed a bumblebee was a banana. He almost looks like an acid but his belly is like that of a het for pieds belly. I donít know how to post his pic if anyone could could me through it.

  2. #2
    Registered User Toad37's Avatar
    Join Date
    11-02-2018
    Location
    Midwest
    Posts
    331
    Thanks
    414
    Thanked 357 Times in 171 Posts

    Re: This is not a woma?

    You can download the Taptalk app. It's a free third party app that lets you post pictures.

  3. #3
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,428
    Thanks
    8,289
    Thanked 6,431 Times in 4,094 Posts
    Images: 92

    Re: This is not a woma?

    We have a sticky that might help you.

    Click here
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  4. #4
    Registered User
    Join Date
    07-16-2019
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: This is not a woma?




    Sent from my iPhone using Tapatalk

  5. #5
    Registered User
    Join Date
    07-16-2019
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: This is not a woma?

    Ok thank you I just used the app


    Sent from my iPhone using Tapatalk

  6. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    790
    Thanks
    80
    Thanked 547 Times in 303 Posts
    I have been working with the Woma morph for over a decade. That animal pictured is definitely NOT a Woma

    I also work with Acid and have followed the project from the very beginning and that animal is not an Acid either.
    Last edited by asplundii; 08-13-2019 at 10:36 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #7
    Registered User
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    243
    Thanks
    130
    Thanked 173 Times in 94 Posts
    At first glance I thought there could be Enchi in there.
    Ball Pythons
    1.0 Champagne Pastel
    1.0 Pastel
    1.0 Normal pos het Pied
    1.0 Spectre
    1.0 Normal
    1.0 100% het Pied
    1.0 Albino
    1.0 Fire
    0.1 Pastel Enchi
    0.1 Butter
    0.1 Fire
    0.2 Yellow Belly
    0.1 Spider
    0.1 Pastel 66% het Pied
    0.2 Normal pos het Pied
    0.1 100% het Pied
    0.5 Normal
    0.1 Pinstripe pos het Pied
    0.1 Bumblebee
    0.1 Super Pastel 66% het Axanthic
    0.1 Mystic
    0.1 Enchi

    Other Pythons
    0.0.2 Carpet Pythons

    BOAS
    1.1 Dumerils
    1.1 Red Tail
    0.0.4 Red Tail

    Corns
    2.1 Amel

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1