» Site Navigation
4 members and 3,440 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,536
Posts: 2,568,715
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Registered User
This is not a woma?
I was told he was a woma. But I’m not so sure as the lady that gave me him also claimed a bumblebee was a banana. He almost looks like an acid but his belly is like that of a het for pieds belly. I don’t know how to post his pic if anyone could could me through it.
-
-
Re: This is not a woma?
You can download the Taptalk app. It's a free third party app that lets you post pictures.
-
-
Re: This is not a woma?
We have a sticky that might help you.
Click here
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
-
Registered User
Re: This is not a woma?
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to Luiibill For This Useful Post:
-
Registered User
Re: This is not a woma?
Ok thank you I just used the app
Sent from my iPhone using Tapatalk
-
-
I have been working with the Woma morph for over a decade. That animal pictured is definitely NOT a Woma
I also work with Acid and have followed the project from the very beginning and that animal is not an Acid either.
Last edited by asplundii; 08-13-2019 at 10:36 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (09-08-2019),Godzilla78 (09-11-2019),Luiibill (09-08-2019)
-
At first glance I thought there could be Enchi in there.
Ball Pythons
1.0 Pinstripe
1.0 Coral Glow Pastel
1.0 Ginger Enchi
1.0 Spectre
1.0 BlackPastel Yellowbelly
1.0 Albino
1.0 Fire
1.0 Enchi Mojave
1.0 Enchi
1.0 Calico
1.0 Leopard
0.1 Mojave Spider
0.1 Butter
0.2 Fire
0.1 Yellow Belly
0.2 Pastel
0.3 Normal
0.1 Bumblebee
0.1 Mystic
0.1 Enchi
0.1 Pinstripe 66% het Pied
0.1 Leopard
Other Pythons
1.0 Carpet Pythons
BOAS
1.1 Dumerils
2.2 Red Tail
Corns
1.2 Amel
-
-
Registered User
Re: This is not a woma?
So not a woma or acid. What’s the difference between hidden gene woma and woma? Maybe a mixture of both possibly?
Sent from my iPhone using Tapatalk
-
-
Re: This is not a woma?
Originally Posted by Luiibill
So not a woma or acid. What’s the difference between hidden gene woma and woma? Maybe a mixture of both possibly?
Woma and Hidden Gene Woma are two entirely different and unrelated morphs. And according to some limited (and, quite frankly, a little suspect) information, they are supposed to be lethal in combination.
I do not have much first hand experience with HGW but to my eye nothing about that animal indicated it is one.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: This is not a woma?
Ok so, what should I do? I’m going to try in get in contact white the lady that sold him to me to see if she knows any more. Not having my hopes up or anything
Sent from my iPhone using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|