Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 291

6 members and 285 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 65,482
Threads: 240,222
Posts: 2,495,742
Top Poster: JLC (31,651)
Welcome to our newest member, LowChevy2k-
Page 1 of 2 12 LastLast
Results 1 to 10 of 17
  1. #1
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    This is not a woma?

    I was told he was a woma. But Iím not so sure as the lady that gave me him also claimed a bumblebee was a banana. He almost looks like an acid but his belly is like that of a het for pieds belly. I donít know how to post his pic if anyone could could me through it.

  2. #2
    Registered User Toad37's Avatar
    Join Date
    11-02-2018
    Location
    Midwest
    Posts
    354
    Thanks
    495
    Thanked 399 Times in 185 Posts

    Re: This is not a woma?

    You can download the Taptalk app. It's a free third party app that lets you post pictures.

  3. #3
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,161
    Thanks
    8,367
    Thanked 6,462 Times in 4,113 Posts
    Images: 92

    Re: This is not a woma?

    We have a sticky that might help you.

    Click here
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  4. #4
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    Re: This is not a woma?




    Sent from my iPhone using Tapatalk

  5. The Following User Says Thank You to Luiibill For This Useful Post:

    Godzilla78 (09-11-2019)

  6. #5
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    Re: This is not a woma?

    Ok thank you I just used the app


    Sent from my iPhone using Tapatalk

  7. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    797
    Thanks
    83
    Thanked 557 Times in 308 Posts
    I have been working with the Woma morph for over a decade. That animal pictured is definitely NOT a Woma

    I also work with Acid and have followed the project from the very beginning and that animal is not an Acid either.
    Last edited by asplundii; 08-13-2019 at 10:36 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (09-08-2019),Godzilla78 (09-11-2019),Luiibill (09-08-2019)

  9. #7
    Registered User
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    250
    Thanks
    135
    Thanked 176 Times in 97 Posts
    At first glance I thought there could be Enchi in there.
    Ball Pythons
    1.0 Champagne Pastel
    1.0 Pastel
    1.0 Normal pos het Pied
    1.0 Spectre
    1.0 Normal
    1.0 100% het Pied
    1.0 Albino
    1.0 Fire
    1.0 Enchi Lesser Spider
    0.1 Pastel Enchi
    0.1 Butter
    0.1 Fire
    0.2 Yellow Belly
    0.1 Spider
    0.1 Pastel 66% het Pied
    0.2 Normal pos het Pied
    0.1 100% het Pied
    0.5 Normal
    0.1 Pinstripe pos het Pied
    0.1 Bumblebee
    0.1 Super Pastel 66% het Axanthic
    0.1 Mystic
    0.1 Enchi

    Other Pythons
    0.0.2 Carpet Pythons

    BOAS
    1.1 Dumerils
    1.1 Red Tail
    0.0.4 Red Tail

    Corns
    2.1 Amel

  10. #8
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    Re: This is not a woma?

    So not a woma or acid. Whatís the difference between hidden gene woma and woma? Maybe a mixture of both possibly?


    Sent from my iPhone using Tapatalk

  11. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    797
    Thanks
    83
    Thanked 557 Times in 308 Posts

    Re: This is not a woma?

    Quote Originally Posted by Luiibill View Post
    So not a woma or acid. Whatís the difference between hidden gene woma and woma? Maybe a mixture of both possibly?
    Woma and Hidden Gene Woma are two entirely different and unrelated morphs. And according to some limited (and, quite frankly, a little suspect) information, they are supposed to be lethal in combination.

    I do not have much first hand experience with HGW but to my eye nothing about that animal indicated it is one.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. #10
    Registered User
    Join Date
    07-16-2019
    Posts
    9
    Thanks
    1
    Thanked 1 Time in 1 Post

    Re: This is not a woma?

    Ok so, what should I do? Iím going to try in get in contact white the lady that sold him to me to see if she knows any more. Not having my hopes up or anything


    Sent from my iPhone using Tapatalk

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1