Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 161

5 members and 156 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.


» Today's Birthdays

miatb (21)

» Stats

Members: 68,881
Threads: 243,354
Posts: 2,524,264
Top Poster: JLC (31,651)
Welcome to our newest member, Arliinoodle
Page 1 of 2 12 LastLast
Results 1 to 10 of 17
  1. #1
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    This is not a woma?

    I was told he was a woma. But Iím not so sure as the lady that gave me him also claimed a bumblebee was a banana. He almost looks like an acid but his belly is like that of a het for pieds belly. I donít know how to post his pic if anyone could could me through it.

  2. #2
    Registered User Toad37's Avatar
    Join Date
    11-02-2018
    Location
    Midwest
    Posts
    469
    Thanks
    917
    Thanked 606 Times in 259 Posts

    Re: This is not a woma?

    You can download the Taptalk app. It's a free third party app that lets you post pictures.

  3. #3
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,518
    Thanks
    9,231
    Thanked 6,765 Times in 4,299 Posts
    Images: 93

    Re: This is not a woma?

    We have a sticky that might help you.

    Click here
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  4. #4
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: This is not a woma?




    Sent from my iPhone using Tapatalk

  5. The Following User Says Thank You to Luiibill For This Useful Post:

    Godzilla78 (09-11-2019)

  6. #5
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: This is not a woma?

    Ok thank you I just used the app


    Sent from my iPhone using Tapatalk

  7. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    869
    Thanks
    91
    Thanked 652 Times in 351 Posts
    I have been working with the Woma morph for over a decade. That animal pictured is definitely NOT a Woma

    I also work with Acid and have followed the project from the very beginning and that animal is not an Acid either.
    Last edited by asplundii; 08-13-2019 at 10:36 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (09-08-2019),Godzilla78 (09-11-2019),Luiibill (09-08-2019)

  9. #7
    BPnet Veteran
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    297
    Thanks
    149
    Thanked 196 Times in 105 Posts
    At first glance I thought there could be Enchi in there.
    Ball Pythons
    1.0 Pinstripe
    1.0 Coral Glow Pastel
    1.0 Ginger Enchi
    1.0 Spectre
    1.0 BlackPastel Yellowbelly
    1.0 Albino
    1.0 Fire
    1.0 Enchi Mojave
    1.0 Enchi
    1.0 Calico
    1.0 Leopard
    0.1 Mojave Spider
    0.1 Butter
    0.2 Fire
    0.1 Yellow Belly
    0.2 Pastel
    0.3 Normal
    0.1 Bumblebee
    0.1 Mystic
    0.1 Enchi
    0.1 Pinstripe 66% het Pied
    0.1 Leopard

    Other Pythons
    1.0 Carpet Pythons

    BOAS
    1.1 Dumerils
    2.2 Red Tail


    Corns
    1.2 Amel

  10. #8
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: This is not a woma?

    So not a woma or acid. Whatís the difference between hidden gene woma and woma? Maybe a mixture of both possibly?


    Sent from my iPhone using Tapatalk

  11. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    869
    Thanks
    91
    Thanked 652 Times in 351 Posts

    Re: This is not a woma?

    Quote Originally Posted by Luiibill View Post
    So not a woma or acid. Whatís the difference between hidden gene woma and woma? Maybe a mixture of both possibly?
    Woma and Hidden Gene Woma are two entirely different and unrelated morphs. And according to some limited (and, quite frankly, a little suspect) information, they are supposed to be lethal in combination.

    I do not have much first hand experience with HGW but to my eye nothing about that animal indicated it is one.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. #10
    Registered User
    Join Date
    07-16-2019
    Posts
    16
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: This is not a woma?

    Ok so, what should I do? Iím going to try in get in contact white the lady that sold him to me to see if she knows any more. Not having my hopes up or anything


    Sent from my iPhone using Tapatalk

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1