Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 658

3 members and 655 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 65,253
Threads: 239,921
Posts: 2,492,590
Top Poster: JLC (31,652)
Welcome to our newest member, Danaday
Results 1 to 6 of 6
  1. #1
    Registered User jsawyer7294's Avatar
    Join Date
    12-14-2018
    Location
    Massachusetts
    Posts
    6
    Thanks
    0
    Thanked 5 Times in 2 Posts

    Clown/OG Project and questions.

    Hi everyone! I recently made the decision to put our Pastel Leopard Vanilla Clown male to our two Orange Ghost girls. One being a Vanilla Orange Ghost and the other being a Pastel Enchi Orange Ghost. Instead of finding a nice OG male. This will be my first year breeding and have two other girls that are breeding as well. Bamboo Pewter x Cinnamon black back and OG Het GStripe poss. het Caramel x GStripe Het OG poss. het caramel. All that being said .. what is the easiest and safest way to get some visual clown/ghost babies? I hear bringing young back to parents very often and is okay as long as there is "new blood" put into the project within a few generations. What are everyone opinions on this matter? Would it be "safer" to try and just buy a visual clown/hypo for any of the girls I produce down the road. Would love to get any feed back on the project itself as well .

  2. #2
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,015
    Thanks
    5,910
    Thanked 19,290 Times in 8,972 Posts
    Blog Entries
    1
    Images: 6
    Double recessive projects are usually done by breeding sibling to sibling. It can be done safely as cold blooded animal breeding and warm blooded animal breeding is very different.

    Now should you bring new blood in when you can? Absolutely but you can build up your base by doing what everyone else does.
    Deborah Stewart

  3. #3
    Registered User jsawyer7294's Avatar
    Join Date
    12-14-2018
    Location
    Massachusetts
    Posts
    6
    Thanks
    0
    Thanked 5 Times in 2 Posts

    Re: Clown/OG Project and questions.

    Exactly what I was thinking just wanted some more input. Definitely appreciate the reply .

  4. #4
    BPnet Veteran rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    964
    Thanks
    741
    Thanked 905 Times in 538 Posts
    Images: 11
    I agree, sibling to sibling is the best bet for double recessive projects. At least that's how I've decided to go for my double recessive projects based on the research I've done. I plan to go visual to visual, holdback one male and put him to all his sibling sisters. Of course the more females you get from that first visual x visual clutch, the better your odds will be of hitting the double recessive with one of the next generation pairings.

    Your project sounds really good, it sounds like you have some really nice animals to make the project super exciting and hopefully if the odds gods are with you, super rewarding as well

    I look forward to seeing how your projects progress, I wish you the best of luck!

  5. #5
    Registered User jsawyer7294's Avatar
    Join Date
    12-14-2018
    Location
    Massachusetts
    Posts
    6
    Thanks
    0
    Thanked 5 Times in 2 Posts

    Re: Clown/OG Project and questions.

    Thank you ! I am super excited to be able to work on a project like this.

  6. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    791
    Thanks
    80
    Thanked 550 Times in 304 Posts

    Re: Clown/OG Project and questions.

    Quote Originally Posted by Stewart_Reptiles View Post
    It can be done safely as cold blooded animal breeding and warm blooded animal breeding is very different.
    This is a fallacy that was put forth back in the early days of the hobby by larger breeders to justify the action. With rare exception, there is no significance difference between cold-blooded and warm-blooded animals when it comes to inbreeding


    Quote Originally Posted by Stewart_Reptiles View Post
    Now should you bring new blood in when you can? Absolutely but you can build up your base by doing what everyone else does.
    This is sound advice. For a generation or two it is not particularly detrimental, but ultimately your goal should be to outcross to maintain diversity
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1